GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-14 11:27:22, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       NM_204648               2039 bp    mRNA    linear   VRT 23-SEP-2023
DEFINITION  Gallus gallus eukaryotic translation initiation factor 2 alpha
            kinase 1 (EIF2AK1), mRNA.
ACCESSION   NM_204648
VERSION     NM_204648.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 2039)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 2039)
  AUTHORS   Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C,
            Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2039)
  AUTHORS   Christiansen JH, Coles EG, Robinson V, Pasini A and Wilkinson DG.
  TITLE     Screening from a subtracted embryonic chick hindbrain cDNA library:
            identification of genes expressed during hindbrain, midbrain and
            cranial neural crest development
  JOURNAL   Mech Dev 102 (1-2), 119-133 (2001)
   PUBMED   11287186
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JAENSK010000257.1.
            
            On Sep 23, 2021 this sequence version replaced NM_204648.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF330008.1, SRR13267659.114430.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA103992290, SAMEA103992323
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-153               JAENSK010000257.1  971301-971453
            154-312             JAENSK010000257.1  971836-971994
            313-449             JAENSK010000257.1  974870-975006
            450-481             JAENSK010000257.1  975745-975776
            482-581             JAENSK010000257.1  976246-976345
            582-662             JAENSK010000257.1  976902-976982
            663-762             JAENSK010000257.1  977420-977519
            763-814             JAENSK010000257.1  979022-979073
            815-1187            JAENSK010000257.1  979718-980090
            1188-1299           JAENSK010000257.1  981080-981191
            1300-1406           JAENSK010000257.1  981919-982025
            1407-1527           JAENSK010000257.1  985607-985727
            1528-1607           JAENSK010000257.1  985814-985893
            1608-1841           JAENSK010000257.1  986418-986651
            1842-2039           JAENSK010000257.1  987065-987262
FEATURES             Location/Qualifiers
     source          1..2039
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="14"
                     /map="14"
     gene            1..2039
                     /gene="EIF2AK1"
                     /note="eukaryotic translation initiation factor 2 alpha
                     kinase 1"
                     /db_xref="CGNC:2470"
                     /db_xref="GeneID:395360"
     exon            1..153
                     /gene="EIF2AK1"
                     /inference="alignment:Splign:2.1.0"
     CDS             57..1964
                     /gene="EIF2AK1"
                     /EC_number="2.7.11.1"
                     /note="eukaryotic initiation factor 2 alpha kinase"
                     /codon_start=1
                     /product="eukaryotic translation initiation factor 2-alpha
                     kinase 1"
                     /protein_id="NP_989979.2"
                     /db_xref="CGNC:2470"
                     /db_xref="GeneID:395360"
                     /translation="
MWRGREVPPRAAAHRPPPAIQFPEESPEPRFDESDVPAELRVANGSQKFVNFTSTIQNQLLLVSLLEHLCHMYTHNLVHSRCLFRILRQAFTRTGLLSPFAFCDEFSTVRLQHNRAITELMKAANRQVLNGELDNGDSRAIGEKEVLLEAQTSRYLNEFDEIARLGKGGYGQVYKVRNKLDGQFYAIKKINIKKATRRDCMKVLREVKVLAGLQHPNIVGYHTAWMEHVQTACPKDKTVLKLQSLPLEQESGDDHCHIQSVESGSSIIFADLTSQEEKSGDSTCLRNPDGESVQNMDVRNDFTNSNSKEICMKPNRCELPIELQEDSDSSVDCRSTDLKHDSSYDPPCSLDLDASAGSKSCTEECSGNDVALCGEFEVEYRLMLYIQMQLCELSLWDWIAARNKRCNERTEDAAGLYHLVDVSWTMKIFEELLEGVCYIHSMGVMHRDIKPRNIFLHGSDHQVKIGDFGLACKDLLWDDADQWFHTERINGLTHTSGVGTCLYASPEQLQGSDYDFKSDMYSLGVILLELFQPFGTEMERAEVITNLRNGHIPHNFCKKWPVQAKYVKLLTSQVSTERPTAAQLRESELFHTTEHVISNLQQKVREQEEEIEKLKEKLRLLSTGQDEHMKQGSPV"
     misc_feature    510..1820
                     /gene="EIF2AK1"
                     /note="Catalytic domain of the Serine/Threonine kinase,
                     eukaryotic translation Initiation Factor 2-Alpha Kinase 2
                     or Heme-Regulated Inhibitor kinase; Region:
                     STKc_EIF2AK1_HRI; cd14049"
                     /db_xref="CDD:270951"
     misc_feature    order(510..518,525..530,666..671,678..683,687..692,
                     714..740,744..746,1206..1208,1368..1370,1377..1385)
                     /gene="EIF2AK1"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:270951"
     misc_feature    528..>1097
                     /gene="EIF2AK1"
                     /note="The protein kinase superfamily is mainly composed
                     of the catalytic domains of serine/threonine-specific and
                     tyrosine-specific protein kinases. It also includes RIO
                     kinases, which are atypical serine protein kinases,
                     aminoglycoside phosphotransferases; Region: Protein
                     Kinases, catalytic domain; cl21453"
                     /db_xref="CDD:473864"
     misc_feature    order(549..554,567..569,573..575,612..614,618..620,
                     1218..1229,1236..1238,1410..1415,1419..1421,1455..1457,
                     1554..1562,1653..1655,1659..1682)
                     /gene="EIF2AK1"
                     /note="active site"
                     /db_xref="CDD:270951"
     misc_feature    order(549..554,567..569,573..575,612..614,618..620,
                     711..713,1218..1229,1236..1238,1398..1400,1404..1406,
                     1410..1415,1419..1421,1455..1457)
                     /gene="EIF2AK1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270951"
     misc_feature    order(549..560,567..569,573..575,612..614,618..620,
                     711..713,834..836,837..839,945..947,954..956,960..962,
                     1062..1067)
                     /gene="EIF2AK1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    order(1452..1481,1527..1562)
                     /gene="EIF2AK1"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270951"
     misc_feature    order(1554..1562,1653..1655,1659..1682)
                     /gene="EIF2AK1"
                     /note="eIF2alpha (substrate) binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270951"
     exon            154..312
                     /gene="EIF2AK1"
                     /inference="alignment:Splign:2.1.0"
     exon            313..449
                     /gene="EIF2AK1"
                     /inference="alignment:Splign:2.1.0"
     exon            450..481
                     /gene="EIF2AK1"
                     /inference="alignment:Splign:2.1.0"
     exon            482..581
                     /gene="EIF2AK1"
                     /inference="alignment:Splign:2.1.0"
     exon            582..662
                     /gene="EIF2AK1"
                     /inference="alignment:Splign:2.1.0"
     exon            663..762
                     /gene="EIF2AK1"
                     /inference="alignment:Splign:2.1.0"
     exon            763..814
                     /gene="EIF2AK1"
                     /inference="alignment:Splign:2.1.0"
     exon            815..1187
                     /gene="EIF2AK1"
                     /inference="alignment:Splign:2.1.0"
     exon            1188..1299
                     /gene="EIF2AK1"
                     /inference="alignment:Splign:2.1.0"
     exon            1300..1406
                     /gene="EIF2AK1"
                     /inference="alignment:Splign:2.1.0"
     exon            1407..1527
                     /gene="EIF2AK1"
                     /inference="alignment:Splign:2.1.0"
     exon            1528..1607
                     /gene="EIF2AK1"
                     /inference="alignment:Splign:2.1.0"
     exon            1608..1841
                     /gene="EIF2AK1"
                     /inference="alignment:Splign:2.1.0"
     exon            1842..2039
                     /gene="EIF2AK1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gtacagaggcgggcaggtgccggcggcgggggaaggccgcgagcgcagcgccgggcatgtggcggggtcgggaggtgccccccagggccgcggcccatcgcccgccgcccgccatccaattccctgaggagagcccggagccgcgcttcgacgagtcggacgtgccggcagaactgcgagtggccaatgggtcacagaagtttgtgaatttcacttcgaccatccagaaccagctgctgctggtgtcgctgctggagcacctgtgccacatgtacacacacaacctcgtgcactcgaggtgcttgttccgaatacttcgacaggctttcacgagaacaggtttgctctccccttttgccttctgtgatgaatttagtactgtaagactgcagcataatagagccattactgagctaatgaaagcagctaaccgacaagtgcttaatggggagcttgataatggagattctcgtgcaattggggaaaaagaagttctcttggaagcacagacatcacgatacttgaatgaatttgatgagattgcaagattaggaaaaggaggatatggccaagtatacaaggtcagaaacaagttagatggtcagttctatgctattaaaaaaatcaatattaagaaggctacaagaagagattgcatgaaggtgctacgagaggttaaagtgctggctggactgcagcatcctaatattgtgggctatcacactgcttggatggaacacgttcaaacagcttgcccaaaagataagacagtattgaagttgcagtcattacccttggaacaggagagtggagatgatcactgtcacattcagagtgtggaaagtggtagttcaattatttttgctgaccttacttcacaagaagaaaagtctggtgacagtacatgtcttagaaatccagatggtgaatcagtgcagaatatggatgtaaggaatgatttcactaacagcaatagtaaggaaatatgtatgaaaccaaatagatgtgaattacccatagaactacaagaagactctgacagtagtgttgactgtagatcaactgatttaaaacatgattcatcgtacgacccaccctgtagtctggatctagatgctagtgctggaagcaagtcctgcactgaagagtgctctgggaatgatgtagctctctgtggagagtttgaggtggagtatcgtttgatgctttatatacagatgcaactgtgtgaactgtccctgtgggactggattgctgcccgtaacaaaagatgcaatgagagaacagaggatgctgctggtctgtaccaccttgtggatgtcagctggacaatgaaaatttttgaagagttattagaaggagtgtgctatatccacagcatgggagtgatgcatcgagacattaaacccagaaatatctttttgcatggatcagatcatcaagttaaaataggagattttggattagcctgcaaagacctcctttgggatgatgcagaccagtggtttcacacagaaaggataaatggactgacacatacctcaggtgtggggacttgcctgtatgcttcaccagaacagctgcaggggtctgactacgacttcaagtcagacatgtacagcttgggtgttatcctgctagaactcttccagccatttggaacagaaatggaaagagcagaagttataacaaatttaaggaatggccacattcctcataacttctgcaagaaatggcctgttcaagccaagtatgtaaaacttctcaccagtcaggtatccacagaaagaccaactgctgctcaacttcgtgaaagtgagctgtttcataccacagaacatgttatttctaatctacagcaaaaggtgagagagcaagaagaagaaatagaaaaactgaaagagaaactaagactgctttctactggacaagatgaacatatgaaacaaggttctccggtttaagtacaggaagaacacaactattgtatattaagttatagaaaacagggtttttttacataaaaatagttcagtgca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]