2024-09-29 09:44:55, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS NM_204648 2039 bp mRNA linear VRT 23-SEP-2023 DEFINITION Gallus gallus eukaryotic translation initiation factor 2 alpha kinase 1 (EIF2AK1), mRNA. ACCESSION NM_204648 VERSION NM_204648.2 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 2039) AUTHORS Tang H, Finn RD and Thomas PD. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 2039) AUTHORS Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C, Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 2039) AUTHORS Christiansen JH, Coles EG, Robinson V, Pasini A and Wilkinson DG. TITLE Screening from a subtracted embryonic chick hindbrain cDNA library: identification of genes expressed during hindbrain, midbrain and cranial neural crest development JOURNAL Mech Dev 102 (1-2), 119-133 (2001) PUBMED 11287186 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from JAENSK010000257.1. On Sep 23, 2021 this sequence version replaced NM_204648.1. ##Evidence-Data-START## Transcript exon combination :: AF330008.1, SRR13267659.114430.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA103992290, SAMEA103992323 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-153 JAENSK010000257.1 971301-971453 154-312 JAENSK010000257.1 971836-971994 313-449 JAENSK010000257.1 974870-975006 450-481 JAENSK010000257.1 975745-975776 482-581 JAENSK010000257.1 976246-976345 582-662 JAENSK010000257.1 976902-976982 663-762 JAENSK010000257.1 977420-977519 763-814 JAENSK010000257.1 979022-979073 815-1187 JAENSK010000257.1 979718-980090 1188-1299 JAENSK010000257.1 981080-981191 1300-1406 JAENSK010000257.1 981919-982025 1407-1527 JAENSK010000257.1 985607-985727 1528-1607 JAENSK010000257.1 985814-985893 1608-1841 JAENSK010000257.1 986418-986651 1842-2039 JAENSK010000257.1 987065-987262 FEATURES Location/Qualifiers source 1..2039 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="14" /map="14" gene 1..2039 /gene="EIF2AK1" /note="eukaryotic translation initiation factor 2 alpha kinase 1" /db_xref="CGNC:2470" /db_xref="GeneID:395360" exon 1..153 /gene="EIF2AK1" /inference="alignment:Splign:2.1.0" CDS 57..1964 /gene="EIF2AK1" /EC_number="2.7.11.1" /note="eukaryotic initiation factor 2 alpha kinase" /codon_start=1 /product="eukaryotic translation initiation factor 2-alpha kinase 1" /protein_id="NP_989979.2" /db_xref="CGNC:2470" /db_xref="GeneID:395360" /translation="
MWRGREVPPRAAAHRPPPAIQFPEESPEPRFDESDVPAELRVANGSQKFVNFTSTIQNQLLLVSLLEHLCHMYTHNLVHSRCLFRILRQAFTRTGLLSPFAFCDEFSTVRLQHNRAITELMKAANRQVLNGELDNGDSRAIGEKEVLLEAQTSRYLNEFDEIARLGKGGYGQVYKVRNKLDGQFYAIKKINIKKATRRDCMKVLREVKVLAGLQHPNIVGYHTAWMEHVQTACPKDKTVLKLQSLPLEQESGDDHCHIQSVESGSSIIFADLTSQEEKSGDSTCLRNPDGESVQNMDVRNDFTNSNSKEICMKPNRCELPIELQEDSDSSVDCRSTDLKHDSSYDPPCSLDLDASAGSKSCTEECSGNDVALCGEFEVEYRLMLYIQMQLCELSLWDWIAARNKRCNERTEDAAGLYHLVDVSWTMKIFEELLEGVCYIHSMGVMHRDIKPRNIFLHGSDHQVKIGDFGLACKDLLWDDADQWFHTERINGLTHTSGVGTCLYASPEQLQGSDYDFKSDMYSLGVILLELFQPFGTEMERAEVITNLRNGHIPHNFCKKWPVQAKYVKLLTSQVSTERPTAAQLRESELFHTTEHVISNLQQKVREQEEEIEKLKEKLRLLSTGQDEHMKQGSPV"
misc_feature 510..1820 /gene="EIF2AK1" /note="Catalytic domain of the Serine/Threonine kinase, eukaryotic translation Initiation Factor 2-Alpha Kinase 2 or Heme-Regulated Inhibitor kinase; Region: STKc_EIF2AK1_HRI; cd14049" /db_xref="CDD:270951" misc_feature order(510..518,525..530,666..671,678..683,687..692, 714..740,744..746,1206..1208,1368..1370,1377..1385) /gene="EIF2AK1" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:270951" misc_feature 528..>1097 /gene="EIF2AK1" /note="The protein kinase superfamily is mainly composed of the catalytic domains of serine/threonine-specific and tyrosine-specific protein kinases. It also includes RIO kinases, which are atypical serine protein kinases, aminoglycoside phosphotransferases; Region: Protein Kinases, catalytic domain; cl21453" /db_xref="CDD:473864" misc_feature order(549..554,567..569,573..575,612..614,618..620, 1218..1229,1236..1238,1410..1415,1419..1421,1455..1457, 1554..1562,1653..1655,1659..1682) /gene="EIF2AK1" /note="active site" /db_xref="CDD:270951" misc_feature order(549..554,567..569,573..575,612..614,618..620, 711..713,1218..1229,1236..1238,1398..1400,1404..1406, 1410..1415,1419..1421,1455..1457) /gene="EIF2AK1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270951" misc_feature order(549..560,567..569,573..575,612..614,618..620, 711..713,834..836,837..839,945..947,954..956,960..962, 1062..1067) /gene="EIF2AK1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270870" misc_feature order(1452..1481,1527..1562) /gene="EIF2AK1" /note="activation loop (A-loop); other site" /db_xref="CDD:270951" misc_feature order(1554..1562,1653..1655,1659..1682) /gene="EIF2AK1" /note="eIF2alpha (substrate) binding site [polypeptide binding]; other site" /db_xref="CDD:270951" exon 154..312 /gene="EIF2AK1" /inference="alignment:Splign:2.1.0" exon 313..449 /gene="EIF2AK1" /inference="alignment:Splign:2.1.0" exon 450..481 /gene="EIF2AK1" /inference="alignment:Splign:2.1.0" exon 482..581 /gene="EIF2AK1" /inference="alignment:Splign:2.1.0" exon 582..662 /gene="EIF2AK1" /inference="alignment:Splign:2.1.0" exon 663..762 /gene="EIF2AK1" /inference="alignment:Splign:2.1.0" exon 763..814 /gene="EIF2AK1" /inference="alignment:Splign:2.1.0" exon 815..1187 /gene="EIF2AK1" /inference="alignment:Splign:2.1.0" exon 1188..1299 /gene="EIF2AK1" /inference="alignment:Splign:2.1.0" exon 1300..1406 /gene="EIF2AK1" /inference="alignment:Splign:2.1.0" exon 1407..1527 /gene="EIF2AK1" /inference="alignment:Splign:2.1.0" exon 1528..1607 /gene="EIF2AK1" /inference="alignment:Splign:2.1.0" exon 1608..1841 /gene="EIF2AK1" /inference="alignment:Splign:2.1.0" exon 1842..2039 /gene="EIF2AK1" /inference="alignment:Splign:2.1.0" ORIGIN
gtacagaggcgggcaggtgccggcggcgggggaaggccgcgagcgcagcgccgggcatgtggcggggtcgggaggtgccccccagggccgcggcccatcgcccgccgcccgccatccaattccctgaggagagcccggagccgcgcttcgacgagtcggacgtgccggcagaactgcgagtggccaatgggtcacagaagtttgtgaatttcacttcgaccatccagaaccagctgctgctggtgtcgctgctggagcacctgtgccacatgtacacacacaacctcgtgcactcgaggtgcttgttccgaatacttcgacaggctttcacgagaacaggtttgctctccccttttgccttctgtgatgaatttagtactgtaagactgcagcataatagagccattactgagctaatgaaagcagctaaccgacaagtgcttaatggggagcttgataatggagattctcgtgcaattggggaaaaagaagttctcttggaagcacagacatcacgatacttgaatgaatttgatgagattgcaagattaggaaaaggaggatatggccaagtatacaaggtcagaaacaagttagatggtcagttctatgctattaaaaaaatcaatattaagaaggctacaagaagagattgcatgaaggtgctacgagaggttaaagtgctggctggactgcagcatcctaatattgtgggctatcacactgcttggatggaacacgttcaaacagcttgcccaaaagataagacagtattgaagttgcagtcattacccttggaacaggagagtggagatgatcactgtcacattcagagtgtggaaagtggtagttcaattatttttgctgaccttacttcacaagaagaaaagtctggtgacagtacatgtcttagaaatccagatggtgaatcagtgcagaatatggatgtaaggaatgatttcactaacagcaatagtaaggaaatatgtatgaaaccaaatagatgtgaattacccatagaactacaagaagactctgacagtagtgttgactgtagatcaactgatttaaaacatgattcatcgtacgacccaccctgtagtctggatctagatgctagtgctggaagcaagtcctgcactgaagagtgctctgggaatgatgtagctctctgtggagagtttgaggtggagtatcgtttgatgctttatatacagatgcaactgtgtgaactgtccctgtgggactggattgctgcccgtaacaaaagatgcaatgagagaacagaggatgctgctggtctgtaccaccttgtggatgtcagctggacaatgaaaatttttgaagagttattagaaggagtgtgctatatccacagcatgggagtgatgcatcgagacattaaacccagaaatatctttttgcatggatcagatcatcaagttaaaataggagattttggattagcctgcaaagacctcctttgggatgatgcagaccagtggtttcacacagaaaggataaatggactgacacatacctcaggtgtggggacttgcctgtatgcttcaccagaacagctgcaggggtctgactacgacttcaagtcagacatgtacagcttgggtgttatcctgctagaactcttccagccatttggaacagaaatggaaagagcagaagttataacaaatttaaggaatggccacattcctcataacttctgcaagaaatggcctgttcaagccaagtatgtaaaacttctcaccagtcaggtatccacagaaagaccaactgctgctcaacttcgtgaaagtgagctgtttcataccacagaacatgttatttctaatctacagcaaaaggtgagagagcaagaagaagaaatagaaaaactgaaagagaaactaagactgctttctactggacaagatgaacatatgaaacaaggttctccggtttaagtacaggaagaacacaactattgtatattaagttatagaaaacagggtttttttacataaaaatagttcagtgca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]