2024-07-03 22:40:47, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NM_204364 1194 bp mRNA linear VRT 09-FEB-2024 DEFINITION Gallus gallus SIX homeobox 3 (SIX3), mRNA. ACCESSION NM_204364 XM_015283827 VERSION NM_204364.2 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1194) AUTHORS Tang,H., Finn,R.D. and Thomas,P.D. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1194) AUTHORS Bovolenta,P., Mallamaci,A., Puelles,L. and Boncinelli,E. TITLE Expression pattern of cSix3, a member of the Six/sine oculis family of transcription factors JOURNAL Mech Dev 70 (1-2), 201-203 (1998) PUBMED 9510037 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AADN05000005.1. On Mar 13, 2018 this sequence version replaced NM_204364.1. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMEA103992432, SAMEA103992440 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-960 AADN05000005.1 15926059-15927018 c 961-1194 AADN05000005.1 15923891-15924124 c FEATURES Location/Qualifiers source 1..1194 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="3" /map="3" /breed="Red Jungle Fowl" gene 1..1194 /gene="SIX3" /gene_synonym="CSIX3" /note="SIX homeobox 3" /db_xref="CGNC:49119" /db_xref="GeneID:378786" exon 1..960 /gene="SIX3" /gene_synonym="CSIX3" /inference="alignment:Splign:2.1.0" misc_feature 44..46 /gene="SIX3" /gene_synonym="CSIX3" /note="upstream in-frame stop codon" CDS 209..1153 /gene="SIX3" /gene_synonym="CSIX3" /note="sine oculis homeobox homolog 3" /codon_start=1 /product="homeobox protein SIX3" /protein_id="NP_989695.1" /db_xref="CGNC:49119" /db_xref="GeneID:378786" /translation="
MVFRSPLELYPTHFFLPNFAADPHHRSLLLASGGSGSGSGCSPGAGGGGGSSRAPHEELSMFQLPTLNFSPEQVASVCETLEETGDIERLGRFLWSLPVAPGACEAINKHESILRARAVVAFHTGNFRDLYHILENHKFTKESHGKLQAMWLEAHYQEAEKLRGRPLGPVDKYRVRKKFPLPRTIWDGEQKTHCFKERTRSLLREWYLQDPYPNPSKKRELAQATGLTPTQVGNWFKNRRQRDRAAAAKNRLQHQAIGQSGMRSLAEPGCPTHSSAESPSTAASPTTSVSSLTERAETGTSILSVTSSDSECDV"
misc_feature 413..754 /gene="SIX3" /gene_synonym="CSIX3" /note="Transcriptional regulator, SIX1, N-terminal SD domain; Region: SIX1_SD; pfam16878" /db_xref="CDD:465293" misc_feature 776..922 /gene="SIX3" /gene_synonym="CSIX3" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:238039" misc_feature order(779..781,788..790,908..910,917..922) /gene="SIX3" /gene_synonym="CSIX3" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 848..1150 /gene="SIX3" /gene_synonym="CSIX3" /note="propagated from UniProtKB/Swiss-Prot (O42406.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" exon 961..1194 /gene="SIX3" /gene_synonym="CSIX3" /inference="alignment:Splign:2.1.0" ORIGIN
ggcggcgcggggccgggcgcgtgtgagcgcgtgagtgtgtgcgtgagtgtgtgcgcgtgtgtgtgcgtgcgtgtgccccgcgcctctatgtggctgcgtgtgcgtgtgcgggtgtggatgcgtgcgcggtgcgggtgccctttcctcccttcttcctccctttctttcttttctccgtgatcgctctccccctctccccggtcatcccatggtgttcaggtccccgctagagctctatcccacccatttcttcctgcccaacttcgccgccgacccgcaccaccgctccctccttctcgccagcggcggcagcggcagcggctcgggctgcagccccggggccggcggcggcggcggcagctcccgggcgccccacgaagagttgtcaatgtttcagctgcccacgctcaacttctccccggagcaagtggccagcgtctgcgagacgctggaggagaccggagacatagagaggctggggaggttcctctggtcgctgccggtggcgccgggggcatgcgaggccatcaacaagcacgagtccatcctgcgcgcccgggcggtggtggccttccacacgggcaacttccgcgacctctaccacatcctggagaaccacaaattcaccaaggagtcgcacggcaagctgcaggccatgtggctcgaagcgcactaccaggaggccgagaagctgcggggccgcccgctggggccggttgataaatacagggtgaggaagaagtttccgctgcccaggaccatttgggatggcgagcagaagacgcactgcttcaaggagaggactcgcagcctcctgagggagtggtacctgcaggacccttaccccaatccgagcaagaaaagggaactggctcaggccacggggctcacccccacgcaagtaggcaactggttcaaaaaccgaaggcaaagagacagagcggcggcggctaaaaacaggctccagcaccaggcgataggacagagcggcatgcggtcgttggcagagcccggctgcccgacgcacagctcggccgagtccccgtccacggcggccagcccgaccaccagcgtctccagtttgacagaaagagccgagacgggcacctccatcctctcggtaacctccagcgactcggaatgtgatgtatgatatcggaaaacaaacaaacaaacaaatcacaacaacaacaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]