2025-06-08 13:15:55, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001397014 1699 bp mRNA linear VRT 06-AUG-2024 DEFINITION Gallus gallus developing brain homeobox 2 (DBX2), mRNA. ACCESSION NM_001397014 VERSION NM_001397014.1 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1699) AUTHORS Tang,H., Finn,R.D. and Thomas,P.D. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1699) AUTHORS Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C., Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1699) AUTHORS Savolainen,P., Fitzsimmons,C., Arvestad,L., Andersson,L. and Lundeberg,J. TITLE ESTs from brain and testis of White Leghorn and red junglefowl: annotation, bioinformatic classification of unknown transcripts and analysis of expression levels JOURNAL Cytogenet Genome Res 111 (1), 79-87 (2005) PUBMED 16093725 REFERENCE 4 (bases 1 to 1699) AUTHORS Boardman,P.E., Sanz-Ezquerro,J., Overton,I.M., Burt,D.W., Bosch,E., Fong,W.T., Tickle,C., Brown,W.R., Wilson,S.A. and Hubbard,S.J. TITLE A comprehensive collection of chicken cDNAs JOURNAL Curr Biol 12 (22), 1965-1969 (2002) PUBMED 12445392 REFERENCE 5 (bases 1 to 1699) AUTHORS Timmer,J.R., Wang,C. and Niswander,L. TITLE BMP signaling patterns the dorsal and intermediate neural tube via regulation of homeobox and helix-loop-helix transcription factors JOURNAL Development 129 (10), 2459-2472 (2002) PUBMED 11973277 REFERENCE 6 (bases 1 to 1699) AUTHORS Rangini,Z., Ben-Yehuda,A., Shapira,E., Gruenbaum,Y. and Fainsod,A. TITLE CHox E, a chicken homeogene of the H2.0 type exhibits dorso-ventral restriction in the proliferating region of the spinal cord JOURNAL Mech Dev 35 (1), 13-24 (1991) PUBMED 1683253 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from CN218458.1, JAENSK010000012.1, HAEK01111759.1, BX929917.2, BU339532.1 and HAEK01023510.1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##Evidence-Data-START## Transcript exon combination :: BX929917.2, HAEK01139842.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN06140855 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-137 CN218458.1 1-137 138-307 JAENSK010000012.1 21077499-21077668 c 308-321 HAEK01111759.1 1-14 322-854 BX929917.2 1-533 855-1283 BU339532.1 204-632 1284-1699 HAEK01023510.1 731-1146 FEATURES Location/Qualifiers source 1..1699 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="1" /map="1" /breed="Red Jungle Fowl" gene 1..1699 /gene="DBX2" /gene_synonym="CHoxE" /note="developing brain homeobox 2" /db_xref="CGNC:7312" /db_xref="GeneID:417801" exon 1..471 /gene="DBX2" /gene_synonym="CHoxE" /inference="alignment:Splign:2.1.0" CDS 135..1073 /gene="DBX2" /gene_synonym="CHoxE" /note="homeobox protein CHox-E; developing brain homeobox protein 2" /codon_start=1 /product="homeobox protein DBX2" /protein_id="NP_001383943.1" /db_xref="CGNC:7312" /db_xref="GeneID:417801" /translation="
MLPSALYWDLVGSSALLNLPAAPGFGSLGKSFLIENLLRAGAPQSPAQLRPLPASPVPLKLCPAAEQISPSGGPYPTRWAFQVLNPSAADGGRLPARAPAADRGGVFPPAATALSKHFFLRAPPFYSACCGGSCQHPASPTAFPREESVLPLLTQESNSKARRGILRRAVFSEDQRKALEKMFQKQKYISKTDRKKLAINLGLKESQVKIWFQNRRMKWRNSKEKEVLSNRCLQEGLQENYLSQSAMNFASPCPSVWEVSQEQTSPRWKEKSPGNSERLTSTQPPPRANSSQSPLYLYPDHDTANKAVTSSD"
misc_feature 633..797 /gene="DBX2" /gene_synonym="CHoxE" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" exon 472..567 /gene="DBX2" /gene_synonym="CHoxE" /inference="alignment:Splign:2.1.0" exon 568..755 /gene="DBX2" /gene_synonym="CHoxE" /inference="alignment:Splign:2.1.0" exon 756..1699 /gene="DBX2" /gene_synonym="CHoxE" /inference="alignment:Splign:2.1.0" ORIGIN
agaggcgcggcgtgcctcccccgagcgctccgctccccgcagccctcccggccccacagcccggcgccccgtcccagcccagtgaggggccgcggcggccgggccgggccgggccgggccgggcggccctcgctatgctgcccagcgcgctgtactgggacctggtgggctcctcggcgctcctcaacctgccggcggcgccgggcttcggcagcctgggcaaaagtttcctcatcgagaacttgctacgggccggcgcgccgcagagccctgcccagctccgtcccctccccgccagccccgtccccctcaagctgtgccccgcggcggaacaaatcagcccctcggggggtccctatccgaccagatgggctttccaagtgcttaacccctcggcggcggacggcggccgcctgccagcacgggctccggcggcggacagaggcggcgtcttcccgccggcggccacagctctttccaaacacttttttctccgagccccgccattctactcagcatgctgcggtgggtcctgtcagcaccctgcatcccccactgcttttccaagagaggaaagtgtcctgcctcttctgacccaggagtctaactccaaagcccggagaggtatattaagaagagctgtcttttccgaagaccagaggaaggctttggagaaaatgtttcagaagcagaagtatatcagtaaaacagacaggaagaaactggcgattaacctgggcctaaaggagtctcaggtgaaaatttggtttcagaatcgaaggatgaagtggcgaaactccaaagaaaaagaagtgctttcaaacaggtgcctccaagaaggtcttcaggaaaactacctctcacagtctgccatgaattttgcctccccatgtccctctgtgtgggaggtgtctcaggagcagacaagtccaaggtggaaggagaagtctccaggaaattctgaaagactgactagtacacaaccacctccaagagcaaactcatcacagagcccactgtatttgtatcctgaccatgacactgcaaataaggcagttacatcatcagactaagaatgtagggccagtttgtaaattgagtggagagtgcaggcttcagatgagaggtcttctaagactaacaatatttggacactgtaaagctaactagttatgcctcctaaatttgctaaagtctaacaccattaaaatgacaactaatgatttaagaaatatttttcaatactcagtcttttcacgtctcttttccagtcttgtaatgaccttaaatgtgaaatagaaattgatggtaagtaaaacaaagtgaagagcatgaagctgaagttttgctctgagttaaacatctgcactgtgtatagattttcattaaaacacactgatagaaaaccacttctatctctcactgcattcagaccaagcaatttattttatgcatgagatgagaataaccctgtttccctgaagataataagttgctttgggttctttttgagattgattaaatgacacagtaggtgtgtattaaacaaatgtaagcatttttggtatgtttccaccatctgtcctcacctgtatcagtatccagctagttgtaaatagcacagtcgcacatcagccaataaccatagtaaagtatgcaataaaaagacagacagccaataaaatggactgtgtttaag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]