GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-06-08 13:15:55, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_001397014            1699 bp    mRNA    linear   VRT 06-AUG-2024
DEFINITION  Gallus gallus developing brain homeobox 2 (DBX2), mRNA.
ACCESSION   NM_001397014
VERSION     NM_001397014.1
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1699)
  AUTHORS   Tang,H., Finn,R.D. and Thomas,P.D.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1699)
  AUTHORS   Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C.,
            Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1699)
  AUTHORS   Savolainen,P., Fitzsimmons,C., Arvestad,L., Andersson,L. and
            Lundeberg,J.
  TITLE     ESTs from brain and testis of White Leghorn and red junglefowl:
            annotation, bioinformatic classification of unknown transcripts and
            analysis of expression levels
  JOURNAL   Cytogenet Genome Res 111 (1), 79-87 (2005)
   PUBMED   16093725
REFERENCE   4  (bases 1 to 1699)
  AUTHORS   Boardman,P.E., Sanz-Ezquerro,J., Overton,I.M., Burt,D.W., Bosch,E.,
            Fong,W.T., Tickle,C., Brown,W.R., Wilson,S.A. and Hubbard,S.J.
  TITLE     A comprehensive collection of chicken cDNAs
  JOURNAL   Curr Biol 12 (22), 1965-1969 (2002)
   PUBMED   12445392
REFERENCE   5  (bases 1 to 1699)
  AUTHORS   Timmer,J.R., Wang,C. and Niswander,L.
  TITLE     BMP signaling patterns the dorsal and intermediate neural tube via
            regulation of homeobox and helix-loop-helix transcription factors
  JOURNAL   Development 129 (10), 2459-2472 (2002)
   PUBMED   11973277
REFERENCE   6  (bases 1 to 1699)
  AUTHORS   Rangini,Z., Ben-Yehuda,A., Shapira,E., Gruenbaum,Y. and Fainsod,A.
  TITLE     CHox E, a chicken homeogene of the H2.0 type exhibits dorso-ventral
            restriction in the proliferating region of the spinal cord
  JOURNAL   Mech Dev 35 (1), 13-24 (1991)
   PUBMED   1683253
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            CN218458.1, JAENSK010000012.1, HAEK01111759.1, BX929917.2,
            BU339532.1 and HAEK01023510.1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BX929917.2, HAEK01139842.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN06140855 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-137               CN218458.1         1-137
            138-307             JAENSK010000012.1  21077499-21077668   c
            308-321             HAEK01111759.1     1-14
            322-854             BX929917.2         1-533
            855-1283            BU339532.1         204-632
            1284-1699           HAEK01023510.1     731-1146
FEATURES             Location/Qualifiers
     source          1..1699
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="1"
                     /map="1"
                     /breed="Red Jungle Fowl"
     gene            1..1699
                     /gene="DBX2"
                     /gene_synonym="CHoxE"
                     /note="developing brain homeobox 2"
                     /db_xref="CGNC:7312"
                     /db_xref="GeneID:417801"
     exon            1..471
                     /gene="DBX2"
                     /gene_synonym="CHoxE"
                     /inference="alignment:Splign:2.1.0"
     CDS             135..1073
                     /gene="DBX2"
                     /gene_synonym="CHoxE"
                     /note="homeobox protein CHox-E; developing brain homeobox
                     protein 2"
                     /codon_start=1
                     /product="homeobox protein DBX2"
                     /protein_id="NP_001383943.1"
                     /db_xref="CGNC:7312"
                     /db_xref="GeneID:417801"
                     /translation="
MLPSALYWDLVGSSALLNLPAAPGFGSLGKSFLIENLLRAGAPQSPAQLRPLPASPVPLKLCPAAEQISPSGGPYPTRWAFQVLNPSAADGGRLPARAPAADRGGVFPPAATALSKHFFLRAPPFYSACCGGSCQHPASPTAFPREESVLPLLTQESNSKARRGILRRAVFSEDQRKALEKMFQKQKYISKTDRKKLAINLGLKESQVKIWFQNRRMKWRNSKEKEVLSNRCLQEGLQENYLSQSAMNFASPCPSVWEVSQEQTSPRWKEKSPGNSERLTSTQPPPRANSSQSPLYLYPDHDTANKAVTSSD"
     misc_feature    633..797
                     /gene="DBX2"
                     /gene_synonym="CHoxE"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            472..567
                     /gene="DBX2"
                     /gene_synonym="CHoxE"
                     /inference="alignment:Splign:2.1.0"
     exon            568..755
                     /gene="DBX2"
                     /gene_synonym="CHoxE"
                     /inference="alignment:Splign:2.1.0"
     exon            756..1699
                     /gene="DBX2"
                     /gene_synonym="CHoxE"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
agaggcgcggcgtgcctcccccgagcgctccgctccccgcagccctcccggccccacagcccggcgccccgtcccagcccagtgaggggccgcggcggccgggccgggccgggccgggccgggcggccctcgctatgctgcccagcgcgctgtactgggacctggtgggctcctcggcgctcctcaacctgccggcggcgccgggcttcggcagcctgggcaaaagtttcctcatcgagaacttgctacgggccggcgcgccgcagagccctgcccagctccgtcccctccccgccagccccgtccccctcaagctgtgccccgcggcggaacaaatcagcccctcggggggtccctatccgaccagatgggctttccaagtgcttaacccctcggcggcggacggcggccgcctgccagcacgggctccggcggcggacagaggcggcgtcttcccgccggcggccacagctctttccaaacacttttttctccgagccccgccattctactcagcatgctgcggtgggtcctgtcagcaccctgcatcccccactgcttttccaagagaggaaagtgtcctgcctcttctgacccaggagtctaactccaaagcccggagaggtatattaagaagagctgtcttttccgaagaccagaggaaggctttggagaaaatgtttcagaagcagaagtatatcagtaaaacagacaggaagaaactggcgattaacctgggcctaaaggagtctcaggtgaaaatttggtttcagaatcgaaggatgaagtggcgaaactccaaagaaaaagaagtgctttcaaacaggtgcctccaagaaggtcttcaggaaaactacctctcacagtctgccatgaattttgcctccccatgtccctctgtgtgggaggtgtctcaggagcagacaagtccaaggtggaaggagaagtctccaggaaattctgaaagactgactagtacacaaccacctccaagagcaaactcatcacagagcccactgtatttgtatcctgaccatgacactgcaaataaggcagttacatcatcagactaagaatgtagggccagtttgtaaattgagtggagagtgcaggcttcagatgagaggtcttctaagactaacaatatttggacactgtaaagctaactagttatgcctcctaaatttgctaaagtctaacaccattaaaatgacaactaatgatttaagaaatatttttcaatactcagtcttttcacgtctcttttccagtcttgtaatgaccttaaatgtgaaatagaaattgatggtaagtaaaacaaagtgaagagcatgaagctgaagttttgctctgagttaaacatctgcactgtgtatagattttcattaaaacacactgatagaaaaccacttctatctctcactgcattcagaccaagcaatttattttatgcatgagatgagaataaccctgtttccctgaagataataagttgctttgggttctttttgagattgattaaatgacacagtaggtgtgtattaaacaaatgtaagcatttttggtatgtttccaccatctgtcctcacctgtatcagtatccagctagttgtaaatagcacagtcgcacatcagccaataaccatagtaaagtatgcaataaaaagacagacagccaataaaatggactgtgtttaag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]