GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-30 02:22:37, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_001396848            2062 bp    mRNA    linear   VRT 24-SEP-2023
DEFINITION  Gallus gallus notochord homeobox (NOTO), transcript variant 1,
            mRNA.
ACCESSION   NM_001396848 XM_015286041
VERSION     NM_001396848.1
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 2062)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 2062)
  AUTHORS   Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C,
            Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2062)
  AUTHORS   Knezevic V, Ranson M and Mackem S.
  TITLE     The organizer-associated chick homeobox gene, Gnot1, is expressed
            before gastrulation and regulated synergistically by activin and
            retinoic acid
  JOURNAL   Dev Biol 171 (2), 458-470 (1995)
   PUBMED   7556928
REFERENCE   4  (bases 1 to 2062)
  AUTHORS   Ranson M, Tickle C, Mahon KA and Mackem S.
  TITLE     Gnot1, a member of a new homeobox gene subfamily, is expressed in a
            dynamic, region-specific domain along the proximodistal axis of the
            developing limb
  JOURNAL   Mech Dev 51 (1), 17-30 (1995)
   PUBMED   7669689
REFERENCE   5  (bases 1 to 2062)
  AUTHORS   Stein S and Kessel M.
  TITLE     A homeobox gene involved in node, notochord and neural plate
            formation of chick embryos
  JOURNAL   Mech Dev 49 (1-2), 37-48 (1995)
   PUBMED   7748788
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000077.1.
            
            On Oct 26, 2021 this sequence version replaced XM_015286041.3.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR13267651.27558.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-214               JAENSK010000077.1  3814748-3814961     c
            215-423             JAENSK010000077.1  3813474-3813682     c
            424-2062            JAENSK010000077.1  3811485-3813123     c
FEATURES             Location/Qualifiers
     source          1..2062
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="4"
                     /map="4"
     gene            1..2062
                     /gene="NOTO"
                     /gene_synonym="CNOT; GNOT1"
                     /note="notochord homeobox"
                     /db_xref="CGNC:49744"
                     /db_xref="GeneID:396302"
     exon            1..214
                     /gene="NOTO"
                     /gene_synonym="CNOT; GNOT1"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    1..3
                     /gene="NOTO"
                     /gene_synonym="CNOT; GNOT1"
                     /note="upstream in-frame stop codon"
     CDS             67..582
                     /gene="NOTO"
                     /gene_synonym="CNOT; GNOT1"
                     /note="isoform 1 is encoded by transcript variant 1; Gnot1
                     homeodomain protein"
                     /codon_start=1
                     /product="notochord homeobox isoform 1"
                     /protein_id="NP_001383777.1"
                     /db_xref="CGNC:49744"
                     /db_xref="GeneID:396302"
                     /translation="
MPPPKTPFHIDALLAEPPRPGPAAPGPPPPIPLPTPGPGAWSWGCRWGGGLELSHCTGADPLGPAVLWRSGGPCKMKRVRTVFKPEQLERLEQEFLKQQYMVGTERVDLAATLRLTETQVKVWFQNRRIKWRKQSMEQKKAKLSQFGVIQPTSAGPTDVKEHEEDTVEVEL"
     misc_feature    295..465
                     /gene="NOTO"
                     /gene_synonym="CNOT; GNOT1"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            215..423
                     /gene="NOTO"
                     /gene_synonym="CNOT; GNOT1"
                     /inference="alignment:Splign:2.1.0"
     exon            424..2062
                     /gene="NOTO"
                     /gene_synonym="CNOT; GNOT1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
tagcagctctccccttccgtcaccccatataaagccgtcgagccggccggcggcacccagccggccatgcctccccccaagacccccttccacatcgacgctctcctcgccgaacccccgcggcccggccccgcagcccccggcccgccgccccccatccctctccccacgccggggccaggagcctggagctggggctgccgctggggaggaggtctggagttgtctcactgcacaggggccgacccgctgggccctgctgtgctgtggaggtctggagggccctgcaaaatgaagagagtgcgcacagtcttcaaaccagagcagttggagaggctggagcaagagttcctcaagcagcagtacatggtgggcacagagcgagtggacctggctgcaacgctgcgtctcacagagacccaggtgaaagtctggttccagaaccggaggatcaaatggaggaagcagagcatggagcagaagaaggcaaagctgtcacagtttggggtgatacagcccacctctgctggccccacggatgtcaaggagcatgaggaggacacagtggaggttgagctttgagcagctgatgggatgcagctgccactgttgtttttgcagccacgcctgcctgatggaggtactggggatgcaggcacatctgtgcttgctttgtccaagctagacttgaagttcttgctctgagagttttgagctacagaactaaactgccattgggtgggaagaagcatccaaaagtgtagagacccctatttggtaaccggtgctgtaactcttggtcttgatggtgccatcgttgtggcaaagcatgtgatctcatttgctctcaaagtgctaggaagcacagtttccaatagagaggctggggtggcggtcagacggtgtctctgatggcagtgagcatggcagcatctgaacatggggtcactcgtgtttcaggtgactgtgtgctcctacgagggagagctgtgctgggaggagatttggctctgatggtttctcctggtcgtcttgattcccatgttggatgctgagatcacaacgacaacaaagtgaaaactgaaaagtcctttgctcccacccgcatcattcttatcattgttgtatttattttcatatatcattcatgcaataaggtgaacagggtctgactctgcccctggagtagaagcgcctctcctcctgtcctgtgccttgctgtcttgcctttcttttgcctttcagagcccagtgtggttttgccttacttcaccatggtgtgcacagggaacaaggggctcctggggctctcaaaggtgcagggaccagggccgttacaaaccagcagctcttcaacacctctgctgcgtcagacggccccctgccctcatccagatgttctggtcctggcccagatggcggctgctcccttctctccttgttacacaccacagcactgtgagaagcagcacctggagagcttggcgagtacatctgcaaccacacactgcagctcgctgtcgtattcctggtgggtgggagggctcggaggggtcaggactgagtattcacgtttccctgtctgtgttttagtaattcctaggggctggtgtgcacagcagcagcagcagcttttggccatgcagccggtgctcaggctgtcacctcatcccagggcaccaggcacaacatctcatgagctcaggataattcatcatgtctctttccaaccccagaatcatagaatcatagaatggcctgggttgaaaaggaccaccaatgatcacccaatttcaacccccctgctatgtgcagggtcgccaaccaccagaccaggctgcccagagccacatccagcctggccttgaatgcttccagggatggggcatccacagcctccttgggcaacctgttccagtgcgtcaccaccctctgagtggaaaaactgtatattgccttcctctagtgttagagagaaaagaaataacatttttttttctttcctccttgccaagtgtcacttctttatttgctttgcttctttaataaagaaagaaactgt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]