ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-10-31 00:56:00, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_001396848 2062 bp mRNA linear VRT 24-SEP-2023 DEFINITION Gallus gallus notochord homeobox (NOTO), transcript variant 1, mRNA. ACCESSION NM_001396848 XM_015286041 VERSION NM_001396848.1 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 2062) AUTHORS Tang H, Finn RD and Thomas PD. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 2062) AUTHORS Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C, Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 2062) AUTHORS Knezevic V, Ranson M and Mackem S. TITLE The organizer-associated chick homeobox gene, Gnot1, is expressed before gastrulation and regulated synergistically by activin and retinoic acid JOURNAL Dev Biol 171 (2), 458-470 (1995) PUBMED 7556928 REFERENCE 4 (bases 1 to 2062) AUTHORS Ranson M, Tickle C, Mahon KA and Mackem S. TITLE Gnot1, a member of a new homeobox gene subfamily, is expressed in a dynamic, region-specific domain along the proximodistal axis of the developing limb JOURNAL Mech Dev 51 (1), 17-30 (1995) PUBMED 7669689 REFERENCE 5 (bases 1 to 2062) AUTHORS Stein S and Kessel M. TITLE A homeobox gene involved in node, notochord and neural plate formation of chick embryos JOURNAL Mech Dev 49 (1-2), 37-48 (1995) PUBMED 7748788 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAENSK010000077.1. On Oct 26, 2021 this sequence version replaced XM_015286041.3. ##Evidence-Data-START## Transcript exon combination :: SRR13267651.27558.1 [ECO:0000332] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-214 JAENSK010000077.1 3814748-3814961 c 215-423 JAENSK010000077.1 3813474-3813682 c 424-2062 JAENSK010000077.1 3811485-3813123 c FEATURES Location/Qualifiers source 1..2062 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="4" /map="4" gene 1..2062 /gene="NOTO" /gene_synonym="CNOT; GNOT1" /note="notochord homeobox" /db_xref="CGNC:49744" /db_xref="GeneID:396302" exon 1..214 /gene="NOTO" /gene_synonym="CNOT; GNOT1" /inference="alignment:Splign:2.1.0" misc_feature 1..3 /gene="NOTO" /gene_synonym="CNOT; GNOT1" /note="upstream in-frame stop codon" CDS 67..582 /gene="NOTO" /gene_synonym="CNOT; GNOT1" /note="isoform 1 is encoded by transcript variant 1; Gnot1 homeodomain protein" /codon_start=1 /product="notochord homeobox isoform 1" /protein_id="NP_001383777.1" /db_xref="CGNC:49744" /db_xref="GeneID:396302" /translation="
MPPPKTPFHIDALLAEPPRPGPAAPGPPPPIPLPTPGPGAWSWGCRWGGGLELSHCTGADPLGPAVLWRSGGPCKMKRVRTVFKPEQLERLEQEFLKQQYMVGTERVDLAATLRLTETQVKVWFQNRRIKWRKQSMEQKKAKLSQFGVIQPTSAGPTDVKEHEEDTVEVEL"
misc_feature 295..465
/gene="NOTO"
/gene_synonym="CNOT; GNOT1"
/note="Region: Homeodomain; pfam00046"
/db_xref="CDD:459649"
exon 215..423
/gene="NOTO"
/gene_synonym="CNOT; GNOT1"
/inference="alignment:Splign:2.1.0"
exon 424..2062
/gene="NOTO"
/gene_synonym="CNOT; GNOT1"
/inference="alignment:Splign:2.1.0"
ORIGIN
tagcagctctccccttccgtcaccccatataaagccgtcgagccggccggcggcacccagccggccatgcctccccccaagacccccttccacatcgacgctctcctcgccgaacccccgcggcccggccccgcagcccccggcccgccgccccccatccctctccccacgccggggccaggagcctggagctggggctgccgctggggaggaggtctggagttgtctcactgcacaggggccgacccgctgggccctgctgtgctgtggaggtctggagggccctgcaaaatgaagagagtgcgcacagtcttcaaaccagagcagttggagaggctggagcaagagttcctcaagcagcagtacatggtgggcacagagcgagtggacctggctgcaacgctgcgtctcacagagacccaggtgaaagtctggttccagaaccggaggatcaaatggaggaagcagagcatggagcagaagaaggcaaagctgtcacagtttggggtgatacagcccacctctgctggccccacggatgtcaaggagcatgaggaggacacagtggaggttgagctttgagcagctgatgggatgcagctgccactgttgtttttgcagccacgcctgcctgatggaggtactggggatgcaggcacatctgtgcttgctttgtccaagctagacttgaagttcttgctctgagagttttgagctacagaactaaactgccattgggtgggaagaagcatccaaaagtgtagagacccctatttggtaaccggtgctgtaactcttggtcttgatggtgccatcgttgtggcaaagcatgtgatctcatttgctctcaaagtgctaggaagcacagtttccaatagagaggctggggtggcggtcagacggtgtctctgatggcagtgagcatggcagcatctgaacatggggtcactcgtgtttcaggtgactgtgtgctcctacgagggagagctgtgctgggaggagatttggctctgatggtttctcctggtcgtcttgattcccatgttggatgctgagatcacaacgacaacaaagtgaaaactgaaaagtcctttgctcccacccgcatcattcttatcattgttgtatttattttcatatatcattcatgcaataaggtgaacagggtctgactctgcccctggagtagaagcgcctctcctcctgtcctgtgccttgctgtcttgcctttcttttgcctttcagagcccagtgtggttttgccttacttcaccatggtgtgcacagggaacaaggggctcctggggctctcaaaggtgcagggaccagggccgttacaaaccagcagctcttcaacacctctgctgcgtcagacggccccctgccctcatccagatgttctggtcctggcccagatggcggctgctcccttctctccttgttacacaccacagcactgtgagaagcagcacctggagagcttggcgagtacatctgcaaccacacactgcagctcgctgtcgtattcctggtgggtgggagggctcggaggggtcaggactgagtattcacgtttccctgtctgtgttttagtaattcctaggggctggtgtgcacagcagcagcagcagcttttggccatgcagccggtgctcaggctgtcacctcatcccagggcaccaggcacaacatctcatgagctcaggataattcatcatgtctctttccaaccccagaatcatagaatcatagaatggcctgggttgaaaaggaccaccaatgatcacccaatttcaacccccctgctatgtgcagggtcgccaaccaccagaccaggctgcccagagccacatccagcctggccttgaatgcttccagggatggggcatccacagcctccttgggcaacctgttccagtgcgtcaccaccctctgagtggaaaaactgtatattgccttcctctagtgttagagagaaaagaaataacatttttttttctttcctccttgccaagtgtcacttctttatttgctttgcttctttaataaagaaagaaactgt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]