2024-07-03 22:46:02, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NM_001277724 1903 bp mRNA linear VRT 17-FEB-2024 DEFINITION Gallus gallus paired related homeobox 1 (PRRX1), mRNA. ACCESSION NM_001277724 NM_001007821 VERSION NM_001277724.3 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1903) AUTHORS Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C., Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 1903) AUTHORS Doufexi,A.E. and Mina,M. TITLE Signaling pathways regulating the expression of Prx1 and Prx2 in the chick mandibular mesenchyme JOURNAL Dev Dyn 237 (11), 3115-3127 (2008) PUBMED 18942149 REMARK GeneRIF: Signaling pathways regulating the expression of Prx1 and Prx2 in the chick mandibular mesenchyme. REFERENCE 3 (bases 1 to 1903) AUTHORS Carre,W., Wang,X., Porter,T.E., Nys,Y., Tang,J., Bernberg,E., Morgan,R., Burnside,J., Aggrey,S.E., Simon,J. and Cogburn,L.A. TITLE Chicken genomics resource: sequencing and annotation of 35,407 ESTs from single and multiple tissue cDNA libraries and CAP3 assembly of a chicken gene index JOURNAL Physiol Genomics 25 (3), 514-524 (2006) PUBMED 16554550 REFERENCE 4 (bases 1 to 1903) AUTHORS Boardman,P.E., Sanz-Ezquerro,J., Overton,I.M., Burt,D.W., Bosch,E., Fong,W.T., Tickle,C., Brown,W.R., Wilson,S.A. and Hubbard,S.J. TITLE A comprehensive collection of chicken cDNAs JOURNAL Curr Biol 12 (22), 1965-1969 (2002) PUBMED 12445392 REFERENCE 5 (bases 1 to 1903) AUTHORS Kataoka,K., Yoshitomo-Nakagawa,K., Shioda,S. and Nishizawa,M. TITLE A set of Hox proteins interact with the Maf oncoprotein to inhibit its DNA binding, transactivation, and transforming activities JOURNAL J Biol Chem 276 (1), 819-826 (2001) PUBMED 11036080 REFERENCE 6 (bases 1 to 1903) AUTHORS Leussink,B., Brouwer,A., el Khattabi,M., Poelmann,R.E., Gittenberger-de Groot,A.C. and Meijlink,F. TITLE Expression patterns of the paired-related homeobox genes MHox/Prx1 and S8/Prx2 suggest roles in development of the heart and the forebrain JOURNAL Mech Dev 52 (1), 51-64 (1995) PUBMED 7577675 REFERENCE 7 (bases 1 to 1903) AUTHORS Kuratani,S., Martin,J.F., Wawersik,S., Lilly,B., Eichele,G. and Olson,E.N. TITLE The expression pattern of the chick homeobox gene gMHox suggests a role in patterning of the limbs and face and in compartmentalization of somites JOURNAL Dev Biol 161 (2), 357-369 (1994) PUBMED 7906232 REFERENCE 8 (bases 1 to 1903) AUTHORS Nohno,T., Koyama,E., Myokai,F., Taniguchi,S., Ohuchi,H., Saito,T. and Noji,S. TITLE A chicken homeobox gene related to Drosophila paired is predominantly expressed in the developing limb JOURNAL Dev Biol 158 (1), 254-264 (1993) PUBMED 8101172 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAENSK010000237.1. On Oct 4, 2021 this sequence version replaced NM_001277724.2. ##Evidence-Data-START## Transcript exon combination :: HAEL01007439.1, SRR13267655.53462.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA3109051 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-498 JAENSK010000237.1 4867768-4868265 c 499-674 JAENSK010000237.1 4842696-4842871 c 675-856 JAENSK010000237.1 4841941-4842122 c 857-1903 JAENSK010000237.1 4835983-4837029 c FEATURES Location/Qualifiers source 1..1903 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="8" /map="8" gene 1..1903 /gene="PRRX1" /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1" /note="paired related homeobox 1" /db_xref="CGNC:48968" /db_xref="GeneID:373941" exon 1..498 /gene="PRRX1" /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1" /inference="alignment:Splign:2.1.0" misc_feature 90..92 /gene="PRRX1" /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1" /note="upstream in-frame stop codon" CDS 258..995 /gene="PRRX1" /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1" /note="paired-related homeotic gene product; homeobox protein MHOX; paired-related homeobox protein 1; transcription factor Prx1b" /codon_start=1 /product="paired mesoderm homeobox protein 1" /protein_id="NP_001264653.1" /db_xref="CGNC:48968" /db_xref="GeneID:373941" /translation="
MASSYAHAMERQALLPARLDGPAGLDNLQAKKNFSVSHLLDLEEAGDMVAAQGDEGGGEPGRSLLESPGLTSGSDTPQQDNDQLNSEEKKKRKQRRNRTTFNSSQLQALERVFERTHYPDAFVREDLARRVNLTEARVQVWFQNRRAKFRRNERAMLASKNASLLKSYSGDVTAVEQPIVPRPAPRPTDYLSWGTASPYSAMATYSTTCTNASPAQGMNMANSIANLRLKAKEYSLQRNQVPTVN"
misc_feature 405..566 /gene="PRRX1" /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1" /note="propagated from UniProtKB/Swiss-Prot (Q05437.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 552..710 /gene="PRRX1" /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" misc_feature 909..962 /gene="PRRX1" /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1" /note="OAR motif; Region: OAR; pfam03826" /db_xref="CDD:461067" misc_feature 921..962 /gene="PRRX1" /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1" /note="propagated from UniProtKB/Swiss-Prot (Q05437.2); Region: OAR. /evidence=ECO:0000255|PROSITE-ProRule:PRU00138" exon 499..674 /gene="PRRX1" /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1" /inference="alignment:Splign:2.1.0" exon 675..856 /gene="PRRX1" /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1" /inference="alignment:Splign:2.1.0" exon 857..1903 /gene="PRRX1" /gene_synonym="gMHox; MHOX; PMX1; Prx-1; Prx1" /inference="alignment:Splign:2.1.0" ORIGIN
acagccaccgttctcctcccggccggcggcagctcctggcgccccgagccggcctctctctcccctccggcatgttttaaggccggccctagcagctctccgttgggctttccttccagccgccccaccgccgtcgggtccccgttccccccgccctcgggccgtgcgcttcccccctcgaagggccggcggctggggggggagcgggggcggtgggcgccgggggggcgagggcagaaaagcccccgctcggcaccatggcgtccagctatgcccacgccatggagaggcaggccctgctgccagcccgcctcgacggccccgccggcctggacaatttacaagccaagaagaacttttccgtgagtcacctgctggacctggaggaggcgggcgacatggtggccgcgcagggggacgagggcggcggcgagcccggccggagcttgttggagtcccccgggctgaccagcggcagcgacaccccgcagcaggacaatgatcagctgaattcagaagagaagaagaaaaggaagcagagaaggaacaggactaccttcaacagcagccagctccaggcactagagagggtctttgagaggacacactaccccgatgcctttgtacgggaagaccttgcacgcagagtcaacctcactgaagccagagttcaggtgtggttccagaaccggagagccaagtttcgccggaatgagagggccatgctggccagcaagaacgcctctctgctcaaatcctactcaggggatgtgaccgccgtggagcagcccatagtacctcgcccagctccaagacccaccgactatctctcctggggtaccgcctcgccttacagtgccatggccacctactccaccacgtgtaccaacgccagcccggcgcagggcatgaatatggccaacagtattgccaacctgagactgaaggcaaaagaatatagtttacagaggaatcaagtgcccacagtcaattaatgactgggggcagctgcttcgcagaaggagaaaatacgacagcacccgtcctgcttcgcaacttctgtgctgaaatttaaaaaaatatattaaaaaatattaaaaaaaagaaaaaaggaaaaaaaaataaaaaaagccaaccccaacccagaactgaacattgggaccaaagcgggagcaaactgaaccgctcgagtgacaaggttcctccttccttttgggataatgccaccattttttttcttgttattgtcaggtttattgcttctgctcaatatactacgagcttcttcagttaaggacagtctcacccttgttgttttccatttttgtatgggactgcaaaaagaaaccttcgctgatctcagcccgcggccgcctcccacccaacaccgcgctgaggctcaaagcttgctcccccaccccagctcaccctagaagaagaaattgtttggtcaccgctttccgttgtatccacctgaccttccgtcccctcccacgtcccttgtgccacagaggcagtgccgttgatgttgactgcgagaagcccattgggcgcgatgggctgggaagcatccctgctgggtcgcctggaccacgacgcaaggaagatctctgtgggcttcgcacactttgtcagcgcctggaaaagccagagaagagagaaaagccaatgtgtgtttgtgagtggggggggggaggatggagaagggtttgctctgtagtgccaagaataggactgttaggacactcctttccatgccttacggcttgtgccacagggagaggcgttgtccagatgcatttgttttatatatactgtatatatttatatatataagatatacatgcaagcttggttggtgttttttattaaacgaaataaaatccattgaaaatgctcggga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]