LOCUS       NM_001252221            1694 bp    mRNA    linear   VRT 27-APR-2025
DEFINITION  Gallus gallus thyroid hormone receptor beta (THRB), transcript
            variant 2, mRNA.
ACCESSION   NM_001252221
VERSION     NM_001252221.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1694)
  AUTHORS   Tang,H., Finn,R.D. and Thomas,P.D.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1694)
  AUTHORS   Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C.,
            Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1694)
  AUTHORS   Lassova,L., Niu,Z., Golden,E.B., Cohen,A.J. and Adams,S.L.
  TITLE     Thyroid hormone treatment of cultured chondrocytes mimics in vivo
            stimulation of collagen X mRNA by increasing BMP 4 expression
  JOURNAL   J Cell Physiol 219 (3), 595-605 (2009)
   PUBMED   19170125
REFERENCE   4  (bases 1 to 1694)
  AUTHORS   Grommen,S.V., Arckens,L., Theuwissen,T., Darras,V.M. and De
            Groef,B.
  TITLE     Thyroid hormone receptor beta2 is strongly up-regulated at all
            levels of the hypothalamo-pituitary-thyroidal axis during late
            embryogenesis in chicken
  JOURNAL   J Endocrinol 196 (3), 519-528 (2008)
   PUBMED   18310447
  REMARK    GeneRIF: changes occur in thyroid hormone (TH) receptor beta2
            (TRbeta2) expression at the different levels of the
            hypothalamo-pituitary-thyroidal (HPT) axis during the last week of
            chicken embryonic development and hatching
REFERENCE   5  (bases 1 to 1694)
  AUTHORS   Cho,Y.S., Kim,E.J., Park,U.H., Sin,H.S. and Um,S.J.
  TITLE     Additional sex comb-like 1 (ASXL1), in cooperation with SRC-1, acts
            as a ligand-dependent coactivator for retinoic acid receptor
  JOURNAL   J Biol Chem 281 (26), 17588-17598 (2006)
   PUBMED   16606617
REFERENCE   6  (bases 1 to 1694)
  AUTHORS   Boardman,P.E., Sanz-Ezquerro,J., Overton,I.M., Burt,D.W., Bosch,E.,
            Fong,W.T., Tickle,C., Brown,W.R., Wilson,S.A. and Hubbard,S.J.
  TITLE     A comprehensive collection of chicken cDNAs
  JOURNAL   Curr Biol 12 (22), 1965-1969 (2002)
   PUBMED   12445392
REFERENCE   7  (bases 1 to 1694)
  AUTHORS   Lachuer,J., Legras,C., Ronfort,C., Barges,S., Cohen-Adad,F.,
            Quivet,L., Duchamp,C., Verdier,G. and Barre,H.
  TITLE     Molecular cloning and sequencing of a cDNA encoding a beta-thyroid
            hormone receptor in muscovy duckling
  JOURNAL   Biochim Biophys Acta 1310 (1), 127-130 (1996)
   PUBMED   9244185
REFERENCE   8  (bases 1 to 1694)
  AUTHORS   Sjoberg,M., Vennstrom,B. and Forrest,D.
  TITLE     Thyroid hormone receptors in chick retinal development:
            differential expression of mRNAs for alpha and N-terminal variant
            beta receptors
  JOURNAL   Development 114 (1), 39-47 (1992)
   PUBMED   1576965
REFERENCE   9  (bases 1 to 1694)
  AUTHORS   Showers,M.O., Darling,D.S., Kieffer,G.D. and Chin,W.W.
  TITLE     Isolation and characterization of a cDNA encoding a chicken beta
            thyroid hormone receptor
  JOURNAL   DNA Cell Biol 10 (3), 211-221 (1991)
   PUBMED   1707280
REFERENCE   10 (bases 1 to 1694)
  AUTHORS   Forrest,D., Sjoberg,M. and Vennstrom,B.
  TITLE     Contrasting developmental and tissue-specific expression of alpha
            and beta thyroid hormone receptor genes
  JOURNAL   EMBO J 9 (5), 1519-1528 (1990)
   PUBMED   1970296
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000037.1, BM490757.1 and BU382230.1.
            
            On Oct 25, 2013 this sequence version replaced NM_001252221.1.
            
            Transcript Variant: This variant (2) differs in the 5' UTR and
            coding region compared to variant 1. The resulting protein (isoform
            2) is longer and has a distinct N-terminus compared to isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data from different strains because no single
            transcript from the same strain was available for the full length
            of the gene. The extent of this transcript is supported by
            transcript alignments and orthologous data.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed sample support SAMEA103992290,
                              SAMEA103992323 [ECO:0006172]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-50                JAENSK010000037.1  6226151-6226200     c
            51-616              BM490757.1         1-566
            617-782             JAENSK010000037.1  6208144-6208309     c
            783-932             BU382230.1         9-158
            933-1186            JAENSK010000037.1  6197079-6197332     c
            1187-1693           BU382230.1         159-665
            1694-1947           JAENSK010000037.1  6197079-6197332     c
FEATURES             Location/Qualifiers
     source          1..1694
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="2"
                     /map="2"
                     /breed="Red Jungle Fowl"
     gene            1..1694
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="thyroid hormone receptor beta"
                     /db_xref="CGNC:49800"
                     /db_xref="GeneID:396431"
     exon            1..347
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    8..10
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="upstream in-frame stop codon"
     CDS             20..1450
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="isoform 2 is encoded by transcript variant 2;
                     beta-thyroid hormone receptor; nuclear receptor subfamily
                     1 group A member 2; thyroid hormone receptor beta 2;
                     thyroid hormone receptor, beta (erythroblastic leukemia
                     viral (v-erb-a) oncogene homolog 2, avian); C-ERBA-BETA"
                     /codon_start=1
                     /product="thyroid hormone receptor beta isoform 2"
                     /protein_id="NP_001239150.1"
                     /db_xref="CGNC:49800"
                     /db_xref="GeneID:396431"
                     /translation="

MNYCMQEIYEVHPAAGSNCYMQSTDYCTYIEDNQGYSSCDAQVLHSNNIYMEQAWAVNQPYTCSYPGNVFKSEYSDMDMALNQYNQPEYFTEEKPTFSQVQSPSYSQKKGYIPSYLDKDELCVVCGDKATGYHYRCITCEGCKGFFRRTIQKNLHPTYSCKYEGKCVIDKVTRNQCQECRFKKCIFVGMATDLVLDDSKRLAKRKLIEENREKRRREELQKTIGHKPEPTDEEWELIKIVTEAHVATNAQGSHWKQKRKFLPEDIGQAPIVNAPEGGKVDLEAFSQFTKIITPAITRVVDFAKKLPMFCELPCEDQIILLKGCCMEIMSLRAAVRYDPESETLTLNGEMAVTRGQLKNGGLGVVSDAIFDLGMSLSSFNLDDTEVALLQAVLLMSSDRPGLVCVERIEKCQEGFLLAFEHYINYRKHHVAHFWPKLLMKVTDLRMIGACHASRFLHMKVECPTELFPPLFLEVFED"

     misc_feature    380..640
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="DNA-binding domain of thyroid hormone receptors
                     (TRs) is composed of two C4-type zinc fingers; Region:
                     NR_DBD_TR; cd06961"
                     /db_xref="CDD:143519"
     misc_feature    order(383..385,392..394,434..436,443..445,497..499,
                     515..517,545..547,554..556)
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="zinc binding site [ion binding]; other site"
                     /db_xref="CDD:143519"
     misc_feature    order(413..421,437..442,446..448,452..454,458..463,
                     470..472,536..541,548..550,557..559,596..604,617..619,
                     626..631,635..640)
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143519"
     misc_feature    order(413..415,422..424,587..589,593..598)
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="heterodimer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:143519"
     misc_feature    710..1438
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="The ligand binding domain of thyroid hormone
                     receptor, a members of a superfamily of nuclear receptors;
                     Region: NR_LBD_TR; cd06935"
                     /db_xref="CDD:132733"
     misc_feature    order(869..871,878..883,887..892,899..901,908..910,
                     992..994,1001..1003,1013..1015,1049..1057,1085..1087,
                     1094..1096,1100..1102,1121..1123,1367..1369,1388..1390,
                     1427..1429)
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:132733"
     misc_feature    order(905..907,914..916,926..928,956..958,968..970,
                     977..979,1421..1426,1433..1435)
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="coactivator recognition site [polypeptide binding];
                     other site"
                     /db_xref="CDD:132733"
     misc_feature    order(1106..1108,1241..1243,1331..1333,1340..1345,
                     1352..1354,1361..1366,1370..1375)
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:132733"
     exon            348..448
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /inference="alignment:Splign:2.1.0"
     exon            449..596
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /inference="alignment:Splign:2.1.0"
     exon            597..802
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /inference="alignment:Splign:2.1.0"
     exon            803..949
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /inference="alignment:Splign:2.1.0"
     exon            950..1208
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /inference="alignment:Splign:2.1.0"
     exon            1209..1694
                     /gene="THRB"
                     /gene_synonym="CTR BETA 2; NR1A2; TR-BETA"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gctgagataggctaacaaaatgaactactgtatgcaagaaatatatgaagtgcacccagctgctggtagcaattgctacatgcagtccactgattattgcacatatatcgaagataatcagggttacagcagttgtgatgctcaggtcctgcacagtaacaacatatatatggaacaggcctgggcggtgaatcagccttatacctgtagttaccctggaaacgtgtttaaaagcgagtactctgacatggacatggccctgaatcagtacaaccaacctgaatatttcaccgaagaaaaacctactttttctcaagtgcagtcgccatcgtactctcagaagaaagggtatatacccagttacttagacaaggatgagctatgtgtagtatgtggggacaaagccaccggatatcattatcgctgcatcacttgtgaaggttgcaagggatttttcagaagaaccattcagaaaaacctccatccaacctattcctgtaaatatgaaggaaaatgtgtgatagacaaagtaacaagaaatcagtgccaggaatgtcgcttcaaaaaatgtatctttgttggcatggcaacagatttggtgttggatgacagcaagaggctggcaaagaggaagctgatagaagaaaatcgagagaagaggcgtcgggaagagctgcagaaaacgattggtcacaaaccagaaccaacagatgaggaatgggagctgatcaaaattgtcactgaagcacatgtggccaccaatgcacaaggaagccactggaagcagaaaaggaaatttctgccagaagacattgggcaagcaccaatagttaatgccccagaaggggggaaagtggatttagaagccttcagccagtttacaaaaattatcacaccagcgattacaagagtggtggattttgccaaaaagttgcctatgttttgtgagctgccatgtgaagaccagatcatccttctgaaaggctgctgtatggagataatgtccctccgagcagcagttcgctatgaccccgagagtgagactttaacgctaaatggggagatggcggtgacaaggggccagctgaaaaatgggggtcttggcgtagtttctgatgccatttttgacctgggcatgtctctttcttcatttaacctggatgacaccgaggttgcccttctccaggctgtcctgctcatgtcatcagatcgcccaggccttgtttgcgtcgagagaatagaaaagtgtcaagagggtttcctcctggcatttgaacactacattaattacagaaaacaccatgttgcacatttttggccaaaactgctgatgaaagtgacagatctgcgaatgattggagcctgccatgccagccgcttcctgcacatgaaggtggagtgccccacagaactcttccctccattgttcctggaggtgtttgaggattagagagactggagcggtcctctgcacccctgtcgcactactggctgtcattccattccattgcccagctcttctcacacctgtttgttcttcttttgttatcttctgattcttgaggtggggttgggcttttgtttgagtttttctctggggttgctgggggcagttgtatacacatggatgaaaacatccctttctgctggtacttgtgactattgcaatttgttcttcagtcctttgatgtgaa

//