ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-26 23:45:51, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_001048076 2040 bp mRNA linear VRT 26-JUN-2025 DEFINITION Gallus gallus vimentin (VIM), mRNA. ACCESSION NM_001048076 XM_418622 VERSION NM_001048076.3 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 2040) AUTHORS Yoshida,Y., Wang,Z., Tehrani,K.F., Pendleton,E.G., Tanaka,R., Mortensen,L.J., Nishimura,S., Tabata,S., Liu,H.X. and Kawabata,F. TITLE Bitter taste receptor T2R7 and umami taste receptor subunit T1R1 are expressed highly in Vimentin-negative taste bud cells in chickens JOURNAL Biochem Biophys Res Commun 511 (2), 280-286 (2019) PUBMED 30782484 REMARK GeneRIF: 3D-reconstructed images clearly revealed that high levels of taste receptor type 2 member 7 and T1R1 were expressed in Vimentin-negative taste bud cells. REFERENCE 2 (bases 1 to 2040) AUTHORS Tang,H., Finn,R.D. and Thomas,P.D. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 3 (bases 1 to 2040) AUTHORS Walker,J.L., Bleaken,B.M., Romisher,A.R., Alnwibit,A.A. and Menko,A.S. TITLE In wound repair vimentin mediates the transition of mesenchymal leader cells to a myofibroblast phenotype JOURNAL Mol Biol Cell 29 (13), 1555-1570 (2018) PUBMED 29718762 REMARK GeneRIF: These findings suggest a novel role for extracellular, cell-surface-associated vimentin in mediating repair-cell function in wound repair and in transitioning these cells to a myofibroblast phenotype. REFERENCE 4 (bases 1 to 2040) AUTHORS Kommata,V. and Dermon,C.R. TITLE Transient vimentin expression during the embryonic development of the chicken cerebellum JOURNAL Int J Dev Neurosci 65, 11-20 (2018) PUBMED 29030097 REMARK GeneRIF: The dats of this study support the possible role of vimentin+ fibers in the structural events of cerebellum corticogenesis, suggesting the participation of radial/Bergmann glia in chicken cerebellum foliation. REFERENCE 5 (bases 1 to 2040) AUTHORS Venkatesan,N., Rajapaksha,P., Payne,J., Goodfellow,F., Wang,Z., Kawabata,F., Tabata,S., Stice,S., Beckstead,R. and Liu,H.X. TITLE Distribution of alpha-Gustducin and Vimentin in premature and mature taste buds in chickens JOURNAL Biochem Biophys Res Commun 479 (2), 305-311 (2016) PUBMED 27639649 REMARK GeneRIF: analysis of alpha-Gustducin and Vimentin distribution in premature and mature taste buds in chickens REFERENCE 6 (bases 1 to 2040) AUTHORS Benes,P., Maceckova,V., Zdrahal,Z., Konecna,H., Zahradnickova,E., Muzik,J. and Smarda,J. TITLE Role of vimentin in regulation of monocyte/macrophage differentiation JOURNAL Differentiation 74 (6), 265-276 (2006) PUBMED 16831196 REMARK GeneRIF: These findings document that up-regulation of vimentin gene expression is important for formation of fully active macrophage-like cells and macrophage polykaryons REFERENCE 7 (bases 1 to 2040) AUTHORS Boardman,P.E., Sanz-Ezquerro,J., Overton,I.M., Burt,D.W., Bosch,E., Fong,W.T., Tickle,C., Brown,W.R., Wilson,S.A. and Hubbard,S.J. TITLE A comprehensive collection of chicken cDNAs JOURNAL Curr Biol 12 (22), 1965-1969 (2002) PUBMED 12445392 REFERENCE 8 (bases 1 to 2040) AUTHORS Zehner,Z.E., Li,Y., Roe,B.A., Paterson,B.M. and Sax,C.M. TITLE The chicken vimentin gene. Nucleotide sequence, regulatory elements, and comparison to the hamster gene JOURNAL J Biol Chem 262 (17), 8112-8120 (1987) PUBMED 3036797 REFERENCE 9 (bases 1 to 2040) AUTHORS Zehner,Z.E. and Paterson,B.M. TITLE The chicken vimentin gene: aspects of organization and transcription during myogenesis JOURNAL Ann N Y Acad Sci 455, 79-94 (1985) PUBMED 3909887 REMARK Review article REFERENCE 10 (bases 1 to 2040) AUTHORS Zehner,Z.E. and Paterson,B.M. TITLE Characterization of the chicken vimentin gene: single copy gene producing multiple mRNAs JOURNAL Proc Natl Acad Sci U S A 80 (4), 911-915 (1983) PUBMED 6573660 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAENSK010000036.1. On Sep 23, 2021 this sequence version replaced NM_001048076.2. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: HAEK01043492.1, HAEL01000258.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2812696, SAMEA3109052 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-618 JAENSK010000036.1 11858718-11859335 c 619-679 JAENSK010000036.1 11858559-11858619 c 680-775 JAENSK010000036.1 11855109-11855204 c 776-937 JAENSK010000036.1 11854804-11854965 c 938-1063 JAENSK010000036.1 11854223-11854348 c 1064-1284 JAENSK010000036.1 11853386-11853606 c 1285-1328 JAENSK010000036.1 11853248-11853291 c 1329-1414 JAENSK010000036.1 11852738-11852823 c 1415-2040 JAENSK010000036.1 11851623-11852248 c FEATURES Location/Qualifiers source 1..2040 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="2" /map="2" gene 1..2040 /gene="VIM" /note="vimentin" /db_xref="CGNC:51275" /db_xref="GeneID:420519" exon 1..618 /gene="VIM" /inference="alignment:Splign:2.1.0" CDS 74..1456 /gene="VIM" /note="vimentin C-terminus" /codon_start=1 /product="vimentin" /protein_id="NP_001041541.2" /db_xref="CGNC:51275" /db_xref="GeneID:420519" /translation="
MSFTSSKNSSYRRMFGGGSRPSSGTRYITSSTRYSLGSALRPSSARYVSASPGGVYATKATSVRLRSSMPPMRMHDAVDFTLADAINTEFKANRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGKGTSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLADDIMRLREKLQEEMLQREEAESTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIRELQAQLQEQHIQIDMDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQEANEYRRQIQSLTCEVDALKGSNESLERQMREMEENFAVEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRINMPIPTFASLNLRETNIESQPIVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"
misc_feature 74..154
/gene="VIM"
/note="propagated from UniProtKB/Swiss-Prot (P09654.2);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 77..340
/gene="VIM"
/note="propagated from UniProtKB/Swiss-Prot (P09654.2);
Region: Head"
misc_feature 98..358
/gene="VIM"
/note="Intermediate filament head (DNA binding) region;
Region: Filament_head; pfam04732"
/db_xref="CDD:461414"
misc_feature 341..448
/gene="VIM"
/note="propagated from UniProtKB/Swiss-Prot (P09654.2);
Region: Coil 1A"
misc_feature 359..1285
/gene="VIM"
/note="Intermediate filament protein; Region: Filament;
pfam00038"
/db_xref="CDD:459643"
misc_feature 449..514
/gene="VIM"
/note="propagated from UniProtKB/Swiss-Prot (P09654.2);
Region: Linker 1"
misc_feature 515..790
/gene="VIM"
/note="propagated from UniProtKB/Swiss-Prot (P09654.2);
Region: Coil 1B"
misc_feature 791..859
/gene="VIM"
/note="propagated from UniProtKB/Swiss-Prot (P09654.2);
Region: Linker 12"
misc_feature 860..1276
/gene="VIM"
/note="propagated from UniProtKB/Swiss-Prot (P09654.2);
Region: Coil 2"
misc_feature 1106..1108
/gene="VIM"
/note="Stutter. /evidence=ECO:0000250; propagated from
UniProtKB/Swiss-Prot (P09654.2); other site"
misc_feature 1277..1453
/gene="VIM"
/note="propagated from UniProtKB/Swiss-Prot (P09654.2);
Region: Tail"
exon 619..679
/gene="VIM"
/inference="alignment:Splign:2.1.0"
exon 680..775
/gene="VIM"
/inference="alignment:Splign:2.1.0"
exon 776..937
/gene="VIM"
/inference="alignment:Splign:2.1.0"
exon 938..1063
/gene="VIM"
/inference="alignment:Splign:2.1.0"
exon 1064..1284
/gene="VIM"
/inference="alignment:Splign:2.1.0"
exon 1285..1328
/gene="VIM"
/inference="alignment:Splign:2.1.0"
exon 1329..1414
/gene="VIM"
/inference="alignment:Splign:2.1.0"
exon 1415..2040
/gene="VIM"
/inference="alignment:Splign:2.1.0"
ORIGIN
gctcttcttcgcccgccgcgctccgagccccgctccgctcccggattacaaagccgctccgttcctcgccgccatgagcttcaccagcagcaagaactcctcgtaccgccgcatgttcggcgggggcagccggcccagcagcggcacccgctacatcacgtccagcacccgctattccctgggcagcgccctgcggcccagcagcgcccgctacgtgtccgcctcgcccggcggcgtgtacgccaccaaggcgacgtcggtgcggctgcggagcagcatgccgcccatgcggatgcacgacgccgtggacttcaccctggcggacgccatcaacacggagttcaaggcgaaccgcaccaacgagaaggtagagctgcaggagctcaacgaccgcttcgccaactacatcgacaaggtgcgcttcctggagcagcagaacaagatcctgctggccgagctggagcagctcaagggcaaaggcacgtcccgcttgggcgacctgtacgaggaggagatgcgggagctgcggcggcaggtggaccagctgaccaacgacaaggcccgcgtcgaggtggagcgcgacaacctggccgacgacatcatgcgcctgcgggagaagttgcaggaggagatgctgcagcgggaggaggccgagagcaccctgcagtccttccgacaggatgttgacaatgcctctctggcacgccttgatcttgagcgcaaagttgagtccctgcaagaagaaattgtcttcttgaagaagcttcatgatgaggaaatccgggaactgcaggctcaactccaggaacagcacatccaaatcgatatggatgtttctaagcctgatcttactgctgccctgcgcgatgttcgtcaacaatatgaaagcgttgctgctaagaatcttcaggaagctgaagagtggtacaagtccaaatttgcagatctctccgaagctgctaataggaacaatgatgccctgcgccaggccaaacaagaagctaatgaatatcgcagacagattcagtctctcacctgtgaagttgatgcccttaaaggaagtaatgaatccctggagcgccagatgcgtgaaatggaggagaattttgctgttgaagctgctaactaccaggacactattggccgcctgcaggatgagattcagaacatgaaggaagaaatggctcgccatcttcgtgagtaccaggacctgctgaatgtaaagatggctcttgatattgagattgctacctacagaaaactgctggagggagaagagagcaggattaacatgcctattccaacctttgcttctttgaacctgagagaaaccaacattgagtctcagccaattgttgacactcactcgaagaggacacttctaattaagaccgtggaaactagagatggacaggttattaatgaaacttcccagcatcacgatgacttggagtaaagctgaagtgaagatgcaaacttaatgcaggagaaattcttaccagcaaggttttaaaaagttcatgtcttaaaggaagaaacagctttcaagtgcctttctccagtttttccatgagcgcaagattattatgctaggaaataggtcttagatcttgcaaactgactctccctgaaggattagagtttacaatggagtctagtttacaaatagcaatatcttgtgctgcaatactgtttttaagtatctgaatttaataaaactgctttttccagcacagtatgagcaacctgtcgctacttcaataaatctttggaaaatggctcttgatgtgttctaatttaacttcatgactttctgcaaagccataacttaatgctggaattactatacggttgacaactccagtactgattgtgtggaatattgttttcagattaactagacaaattgtcttcccatctactgcttaggttttggaaccaattaaaatggactataactggcagatgcataatgtattgatacttatcagttgaataaaatgatacttcaagctaataaaaattaatcttgctttcata
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]