GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-26 23:45:51, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_001048076            2040 bp    mRNA    linear   VRT 26-JUN-2025
DEFINITION  Gallus gallus vimentin (VIM), mRNA.
ACCESSION   NM_001048076 XM_418622
VERSION     NM_001048076.3
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 2040)
  AUTHORS   Yoshida,Y., Wang,Z., Tehrani,K.F., Pendleton,E.G., Tanaka,R.,
            Mortensen,L.J., Nishimura,S., Tabata,S., Liu,H.X. and Kawabata,F.
  TITLE     Bitter taste receptor T2R7 and umami taste receptor subunit T1R1
            are expressed highly in Vimentin-negative taste bud cells in
            chickens
  JOURNAL   Biochem Biophys Res Commun 511 (2), 280-286 (2019)
   PUBMED   30782484
  REMARK    GeneRIF: 3D-reconstructed images clearly revealed that high levels
            of taste receptor type 2 member 7 and T1R1 were expressed in
            Vimentin-negative taste bud cells.
REFERENCE   2  (bases 1 to 2040)
  AUTHORS   Tang,H., Finn,R.D. and Thomas,P.D.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   3  (bases 1 to 2040)
  AUTHORS   Walker,J.L., Bleaken,B.M., Romisher,A.R., Alnwibit,A.A. and
            Menko,A.S.
  TITLE     In wound repair vimentin mediates the transition of mesenchymal
            leader cells to a myofibroblast phenotype
  JOURNAL   Mol Biol Cell 29 (13), 1555-1570 (2018)
   PUBMED   29718762
  REMARK    GeneRIF: These findings suggest a novel role for extracellular,
            cell-surface-associated vimentin in mediating repair-cell function
            in wound repair and in transitioning these cells to a myofibroblast
            phenotype.
REFERENCE   4  (bases 1 to 2040)
  AUTHORS   Kommata,V. and Dermon,C.R.
  TITLE     Transient vimentin expression during the embryonic development of
            the chicken cerebellum
  JOURNAL   Int J Dev Neurosci 65, 11-20 (2018)
   PUBMED   29030097
  REMARK    GeneRIF: The dats of this study support the possible role of
            vimentin+ fibers in the structural events of cerebellum
            corticogenesis, suggesting the participation of radial/Bergmann
            glia in chicken cerebellum foliation.
REFERENCE   5  (bases 1 to 2040)
  AUTHORS   Venkatesan,N., Rajapaksha,P., Payne,J., Goodfellow,F., Wang,Z.,
            Kawabata,F., Tabata,S., Stice,S., Beckstead,R. and Liu,H.X.
  TITLE     Distribution of alpha-Gustducin and Vimentin in premature and
            mature taste buds in chickens
  JOURNAL   Biochem Biophys Res Commun 479 (2), 305-311 (2016)
   PUBMED   27639649
  REMARK    GeneRIF: analysis of alpha-Gustducin and Vimentin distribution in
            premature and mature taste buds in chickens
REFERENCE   6  (bases 1 to 2040)
  AUTHORS   Benes,P., Maceckova,V., Zdrahal,Z., Konecna,H., Zahradnickova,E.,
            Muzik,J. and Smarda,J.
  TITLE     Role of vimentin in regulation of monocyte/macrophage
            differentiation
  JOURNAL   Differentiation 74 (6), 265-276 (2006)
   PUBMED   16831196
  REMARK    GeneRIF: These findings document that up-regulation of vimentin
            gene expression is important for formation of fully active
            macrophage-like cells and macrophage polykaryons
REFERENCE   7  (bases 1 to 2040)
  AUTHORS   Boardman,P.E., Sanz-Ezquerro,J., Overton,I.M., Burt,D.W., Bosch,E.,
            Fong,W.T., Tickle,C., Brown,W.R., Wilson,S.A. and Hubbard,S.J.
  TITLE     A comprehensive collection of chicken cDNAs
  JOURNAL   Curr Biol 12 (22), 1965-1969 (2002)
   PUBMED   12445392
REFERENCE   8  (bases 1 to 2040)
  AUTHORS   Zehner,Z.E., Li,Y., Roe,B.A., Paterson,B.M. and Sax,C.M.
  TITLE     The chicken vimentin gene. Nucleotide sequence, regulatory
            elements, and comparison to the hamster gene
  JOURNAL   J Biol Chem 262 (17), 8112-8120 (1987)
   PUBMED   3036797
REFERENCE   9  (bases 1 to 2040)
  AUTHORS   Zehner,Z.E. and Paterson,B.M.
  TITLE     The chicken vimentin gene: aspects of organization and
            transcription during myogenesis
  JOURNAL   Ann N Y Acad Sci 455, 79-94 (1985)
   PUBMED   3909887
  REMARK    Review article
REFERENCE   10 (bases 1 to 2040)
  AUTHORS   Zehner,Z.E. and Paterson,B.M.
  TITLE     Characterization of the chicken vimentin gene: single copy gene
            producing multiple mRNAs
  JOURNAL   Proc Natl Acad Sci U S A 80 (4), 911-915 (1983)
   PUBMED   6573660
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000036.1.
            
            On Sep 23, 2021 this sequence version replaced NM_001048076.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: HAEK01043492.1, HAEL01000258.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2812696, SAMEA3109052
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-618               JAENSK010000036.1  11858718-11859335   c
            619-679             JAENSK010000036.1  11858559-11858619   c
            680-775             JAENSK010000036.1  11855109-11855204   c
            776-937             JAENSK010000036.1  11854804-11854965   c
            938-1063            JAENSK010000036.1  11854223-11854348   c
            1064-1284           JAENSK010000036.1  11853386-11853606   c
            1285-1328           JAENSK010000036.1  11853248-11853291   c
            1329-1414           JAENSK010000036.1  11852738-11852823   c
            1415-2040           JAENSK010000036.1  11851623-11852248   c
FEATURES             Location/Qualifiers
     source          1..2040
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="2"
                     /map="2"
     gene            1..2040
                     /gene="VIM"
                     /note="vimentin"
                     /db_xref="CGNC:51275"
                     /db_xref="GeneID:420519"
     exon            1..618
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     CDS             74..1456
                     /gene="VIM"
                     /note="vimentin C-terminus"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="NP_001041541.2"
                     /db_xref="CGNC:51275"
                     /db_xref="GeneID:420519"
                     /translation="
MSFTSSKNSSYRRMFGGGSRPSSGTRYITSSTRYSLGSALRPSSARYVSASPGGVYATKATSVRLRSSMPPMRMHDAVDFTLADAINTEFKANRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGKGTSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLADDIMRLREKLQEEMLQREEAESTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIRELQAQLQEQHIQIDMDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQEANEYRRQIQSLTCEVDALKGSNESLERQMREMEENFAVEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRINMPIPTFASLNLRETNIESQPIVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"
     misc_feature    74..154
                     /gene="VIM"
                     /note="propagated from UniProtKB/Swiss-Prot (P09654.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    77..340
                     /gene="VIM"
                     /note="propagated from UniProtKB/Swiss-Prot (P09654.2);
                     Region: Head"
     misc_feature    98..358
                     /gene="VIM"
                     /note="Intermediate filament head (DNA binding) region;
                     Region: Filament_head; pfam04732"
                     /db_xref="CDD:461414"
     misc_feature    341..448
                     /gene="VIM"
                     /note="propagated from UniProtKB/Swiss-Prot (P09654.2);
                     Region: Coil 1A"
     misc_feature    359..1285
                     /gene="VIM"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:459643"
     misc_feature    449..514
                     /gene="VIM"
                     /note="propagated from UniProtKB/Swiss-Prot (P09654.2);
                     Region: Linker 1"
     misc_feature    515..790
                     /gene="VIM"
                     /note="propagated from UniProtKB/Swiss-Prot (P09654.2);
                     Region: Coil 1B"
     misc_feature    791..859
                     /gene="VIM"
                     /note="propagated from UniProtKB/Swiss-Prot (P09654.2);
                     Region: Linker 12"
     misc_feature    860..1276
                     /gene="VIM"
                     /note="propagated from UniProtKB/Swiss-Prot (P09654.2);
                     Region: Coil 2"
     misc_feature    1106..1108
                     /gene="VIM"
                     /note="Stutter. /evidence=ECO:0000250; propagated from
                     UniProtKB/Swiss-Prot (P09654.2); other site"
     misc_feature    1277..1453
                     /gene="VIM"
                     /note="propagated from UniProtKB/Swiss-Prot (P09654.2);
                     Region: Tail"
     exon            619..679
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     exon            680..775
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     exon            776..937
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     exon            938..1063
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     exon            1064..1284
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     exon            1285..1328
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     exon            1329..1414
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
     exon            1415..2040
                     /gene="VIM"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gctcttcttcgcccgccgcgctccgagccccgctccgctcccggattacaaagccgctccgttcctcgccgccatgagcttcaccagcagcaagaactcctcgtaccgccgcatgttcggcgggggcagccggcccagcagcggcacccgctacatcacgtccagcacccgctattccctgggcagcgccctgcggcccagcagcgcccgctacgtgtccgcctcgcccggcggcgtgtacgccaccaaggcgacgtcggtgcggctgcggagcagcatgccgcccatgcggatgcacgacgccgtggacttcaccctggcggacgccatcaacacggagttcaaggcgaaccgcaccaacgagaaggtagagctgcaggagctcaacgaccgcttcgccaactacatcgacaaggtgcgcttcctggagcagcagaacaagatcctgctggccgagctggagcagctcaagggcaaaggcacgtcccgcttgggcgacctgtacgaggaggagatgcgggagctgcggcggcaggtggaccagctgaccaacgacaaggcccgcgtcgaggtggagcgcgacaacctggccgacgacatcatgcgcctgcgggagaagttgcaggaggagatgctgcagcgggaggaggccgagagcaccctgcagtccttccgacaggatgttgacaatgcctctctggcacgccttgatcttgagcgcaaagttgagtccctgcaagaagaaattgtcttcttgaagaagcttcatgatgaggaaatccgggaactgcaggctcaactccaggaacagcacatccaaatcgatatggatgtttctaagcctgatcttactgctgccctgcgcgatgttcgtcaacaatatgaaagcgttgctgctaagaatcttcaggaagctgaagagtggtacaagtccaaatttgcagatctctccgaagctgctaataggaacaatgatgccctgcgccaggccaaacaagaagctaatgaatatcgcagacagattcagtctctcacctgtgaagttgatgcccttaaaggaagtaatgaatccctggagcgccagatgcgtgaaatggaggagaattttgctgttgaagctgctaactaccaggacactattggccgcctgcaggatgagattcagaacatgaaggaagaaatggctcgccatcttcgtgagtaccaggacctgctgaatgtaaagatggctcttgatattgagattgctacctacagaaaactgctggagggagaagagagcaggattaacatgcctattccaacctttgcttctttgaacctgagagaaaccaacattgagtctcagccaattgttgacactcactcgaagaggacacttctaattaagaccgtggaaactagagatggacaggttattaatgaaacttcccagcatcacgatgacttggagtaaagctgaagtgaagatgcaaacttaatgcaggagaaattcttaccagcaaggttttaaaaagttcatgtcttaaaggaagaaacagctttcaagtgcctttctccagtttttccatgagcgcaagattattatgctaggaaataggtcttagatcttgcaaactgactctccctgaaggattagagtttacaatggagtctagtttacaaatagcaatatcttgtgctgcaatactgtttttaagtatctgaatttaataaaactgctttttccagcacagtatgagcaacctgtcgctacttcaataaatctttggaaaatggctcttgatgtgttctaatttaacttcatgactttctgcaaagccataacttaatgctggaattactatacggttgacaactccagtactgattgtgtggaatattgttttcagattaactagacaaattgtcttcccatctactgcttaggttttggaaccaattaaaatggactataactggcagatgcataatgtattgatacttatcagttgaataaaatgatacttcaagctaataaaaattaatcttgctttcata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]