GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-03-04 12:35:39, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_005164667            1781 bp    mRNA    linear   VRT 08-SEP-2024
DEFINITION  PREDICTED: Danio rerio wingless-type MMTV integration site family,
            member 16 (wnt16), transcript variant X1, mRNA.
ACCESSION   XM_005164667
VERSION     XM_005164667.5
DBLINK      BioProject: PRJNA13922
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_007115.7) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Sep 8, 2024 this sequence version replaced XM_005164667.4.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_000002035.6-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/15/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1781
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="4"
     gene            1..1781
                     /gene="wnt16"
                     /gene_synonym="zgc:77293"
                     /note="wingless-type MMTV integration site family, member
                     16; Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 1 mRNA, 10 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 25 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:791563"
                     /db_xref="ZFIN:ZDB-GENE-040426-2330"
     misc_feature    1
                     /gene="wnt16"
                     /gene_synonym="zgc:77293"
                     /experiment="COORDINATES: cap analysis [ECO:0007248]"
                     /note="transcription start site"
     CDS             587..1306
                     /gene="wnt16"
                     /gene_synonym="zgc:77293"
                     /codon_start=1
                     /product="protein Wnt-16 isoform X1"
                     /protein_id="XP_005164724.1"
                     /db_xref="GeneID:791563"
                     /db_xref="ZFIN:ZDB-GENE-040426-2330"
                     /translation="
MAAGLVHAVTRSCSAGNMTECSCDTSLLGSGSPTEGWHWGGCSDDIAFGTSFSRRFIDSAAKNTSTRGEEALLIMKQHNSEAGRQAVAKTMLTDCRCHGVSGSCAVKTCWRTMAAFERVGAYLKDRYETSVHVVDRSKRKVRRKDKEQRHVPITKDELIFFNKSPNYCLEDRRLGVTGTRGRKCNRTSAGPDGCNLLCCGRGYNTHVVRHVERCECKFVWCCYVRCRRCETMNDMHTCK"
     misc_feature    <587..1303
                     /gene="wnt16"
                     /gene_synonym="zgc:77293"
                     /note="Wnt domain found in the WNT signaling gene family,
                     also called Wingless-type mouse mammary tumor virus (MMTV)
                     integration site family; Region: Wnt; cl38924"
                     /db_xref="CDD:393294"
     misc_feature    order(872..877,884..892,914..916,1238..1240,1244..1246,
                     1250..1252,1256..1258)
                     /gene="wnt16"
                     /gene_synonym="zgc:77293"
                     /note="Frizzled receptor binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:381706"
     polyA_site      1781
                     /gene="wnt16"
                     /gene_synonym="zgc:77293"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
gctcatggcgaaggtgacttgctggtggttggacgttacctgcgtcttgatggattcttaaaacggagacttaaaagcgtcgtttgtggattacaggtgctacatattagatgcagtggaccggcatgaatcgtctttgtcaaaacgttcagttcgggacttgttaaatgaagtggacatggataataccggttgtgggatacatgcagttcatcatttattccttatatggctctccgtttaccctttgtgctctcagggaagttggatgccgacaggagaggagaaccgcttctgatctttgtgtcacactgctccgcatcacaggtggttgggcatcacatctgtaggagtgcccgagaagttgggttgcgcgcatttgcccctgtcgcacaagcagaaggagctgtgcgcgcgcaaaccgcatcttctaccgagcgttaaagagggcgcgcgcctgggcatcaccgagtgccaaactcagttcagacacgaacgctggaactgctcgacccgacgggacccgaacgtgttcggctacgagctcacgagcgggactaaagagacagcgttcatccatgcagtaatggctgccggcctggttcatgcagtcacccgctcttgcagtgcaggaaatatgacagagtgttcatgtgacacaagcctgttgggcagcgggtcgcccaccgagggctggcattggggcggctgctctgatgacatcgccttcgggacttcattcagccgccgctttattgacagtgcagcgaaaaacacctcgacccgtggtgaggaggccctgctcattatgaagcagcataacagtgaggctgggagacaggcggtggccaaaacaatgttgacagactgccgctgtcatggcgtatcgggttcatgtgcggtaaagacgtgttggcgcacaatggctgcatttgagcgtgtgggcgcctacctgaaggatcgctatgaaaccagcgttcatgttgtggaccgttccaaacgtaaggtgcgacgcaaggataaagagcaacgccatgtgcctatcaccaaagatgagttaatcttcttcaacaaatcgcccaattattgcttggaggaccggcggctgggcgtgacggggaccaggggccgcaagtgtaacagaacttcggccgggcccgacggctgcaacctgctgtgctgcggacggggatacaacacacatgtggtgcgacatgtagagcgctgcgagtgtaagttcgtctggtgctgttatgttcgctgcagacgctgcgagacaatgaatgacatgcacacctgcaagtaaagcagcgacttcgggcgaggttgaaggatctcgtgagaggaaatggaccttctttgtgctgtcagcctatacaaacaagcatgttgacgaaatatccaaccggcaatacgtagctgaatccataaagaaatggtataatccttttttaagtacacatgcataactcttcccatgggtttccattgggagtcaagccattttgtatataatgactgtggaataaactggagcataaagggaattcaaatactgggaattgcagaggaaaagtgtaaatactttagataactctgtttggattttttactgaaggcatgttcggataaagagttagctgaccttaaaatgaaaagtttgtcaaaattagtctttccaactcacctcttcactttttcccaacccaaatcttcattaaaaaattattaaaagtaggatcactcaaacatttcgtaaataaaaactattattcaattca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]