ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-27 13:21:41, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_039274 73 bp RNA linear VRT 07-JUN-2025
DEFINITION Danio rerio microRNA 430c-18 (dre-mir-430c-18), microRNA.
ACCESSION NR_039274 NR_034227
VERSION NR_039274.1
KEYWORDS RefSeq.
SOURCE Danio rerio (zebrafish)
ORGANISM Danio rerio
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE 1 (bases 1 to 73)
AUTHORS Hadzhiev,Y., Wheatley,L., Cooper,L., Ansaloni,F., Whalley,C.,
Chen,Z., Finaurini,S., Gustincich,S., Sanges,R., Burgess,S.,
Beggs,A. and Muller,F.
TITLE The miR-430 locus with extreme promoter density forms a
transcription body during the minor wave of zygotic genome
activation
JOURNAL Dev Cell 58 (2), 155-170 (2023)
PUBMED 36693321
REFERENCE 2 (bases 1 to 73)
AUTHORS Miao,L., Tang,Y., Bonneau,A.R., Chan,S.H., Kojima,M.L.,
Pownall,M.E., Vejnar,C.E., Gao,F., Krishnaswamy,S., Hendry,C.E. and
Giraldez,A.J.
TITLE The landscape of pioneer factor activity reveals the mechanisms of
chromatin reprogramming and genome activation
JOURNAL Mol Cell 82 (5), 986-1002 (2022)
PUBMED 35182480
REFERENCE 3 (bases 1 to 73)
AUTHORS D'Orazio,F.M., Balwierz,P.J., Gonzalez,A.J., Guo,Y.,
Hernandez-Rodriguez,B., Wheatley,L., Jasiulewicz,A., Hadzhiev,Y.,
Vaquerizas,J.M., Cairns,B., Lenhard,B. and Muller,F.
TITLE Germ cell differentiation requires Tdrd7-dependent chromatin and
transcriptome reprogramming marked by germ plasm relocalization
JOURNAL Dev Cell 56 (5), 641-656 (2021)
PUBMED 33651978
REFERENCE 4 (bases 1 to 73)
AUTHORS Chan,S.H., Tang,Y., Miao,L., Darwich-Codore,H., Vejnar,C.E.,
Beaudoin,J.D., Musaev,D., Fernandez,J.P., Benitez,M.D.J.,
Bazzini,A.A., Moreno-Mateos,M.A. and Giraldez,A.J.
TITLE Brd4 and P300 Confer Transcriptional Competency during Zygotic
Genome Activation
JOURNAL Dev Cell 49 (6), 867-881 (2019)
PUBMED 31211993
REFERENCE 5 (bases 1 to 73)
AUTHORS Hadzhiev,Y., Qureshi,H.K., Wheatley,L., Cooper,L., Jasiulewicz,A.,
Van Nguyen,H., Wragg,J.W., Poovathumkadavil,D., Conic,S., Bajan,S.,
Sik,A., Hutvagner,G., Tora,L., Gambus,A., Fossey,J.S. and Muller,F.
TITLE A cell cycle-coordinated Polymerase II transcription compartment
encompasses gene expression before global genome activation
JOURNAL Nat Commun 10 (1), 691 (2019)
PUBMED 30741925
REMARK Publication Status: Online-Only
REFERENCE 6 (bases 1 to 73)
AUTHORS Liu,Y., Luo,D., Zhao,H., Zhu,Z., Hu,W. and Cheng,C.H.
TITLE Inheritable and precise large genomic deletions of non-coding RNA
genes in zebrafish using TALENs
JOURNAL PLoS One 8 (10), e76387 (2013)
PUBMED 24130773
REMARK Publication Status: Online-Only
REFERENCE 7 (bases 1 to 73)
AUTHORS Cifuentes,D., Xue,H., Taylor,D.W., Patnode,H., Mishima,Y.,
Cheloufi,S., Ma,E., Mane,S., Hannon,G.J., Lawson,N.D., Wolfe,S.A.
and Giraldez,A.J.
TITLE A novel miRNA processing pathway independent of Dicer requires
Argonaute2 catalytic activity
JOURNAL Science 328 (5986), 1694-1698 (2010)
PUBMED 20448148
REFERENCE 8 (bases 1 to 73)
AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
Enright,A.J.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
REFERENCE 9 (bases 1 to 73)
AUTHORS Chen,P.Y., Manninga,H., Slanchev,K., Chien,M., Russo,J.J., Ju,J.,
Sheridan,R., John,B., Marks,D.S., Gaidatzis,D., Sander,C.,
Zavolan,M. and Tuschl,T.
TITLE The developmental miRNA profiles of zebrafish as determined by
small RNA cloning
JOURNAL Genes Dev 19 (11), 1288-1293 (2005)
PUBMED 15937218
REFERENCE 10 (bases 1 to 73)
AUTHORS Giraldez,A.J., Cinalli,R.M., Glasner,M.E., Enright,A.J.,
Thomson,J.M., Baskerville,S., Hammond,S.M., Bartel,D.P. and
Schier,A.F.
TITLE MicroRNAs regulate brain morphogenesis in zebrafish
JOURNAL Science 308 (5723), 833-838 (2005)
PUBMED 15774722
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from JBMGRA010000004.1.
On Jan 14, 2013 this sequence version replaced NR_034227.1.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
##Evidence-Data-START##
Transcript is intronless :: SRR32588722.4172374.1,
SRR32588729.33587756.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-73 JBMGRA010000004.1 31285135-31285207
FEATURES Location/Qualifiers
source 1..73
/organism="Danio rerio"
/mol_type="transcribed RNA"
/strain="Tuebingen"
/db_xref="taxon:7955"
/chromosome="4"
/map="4"
gene 1..73
/gene="dre-mir-430c-18"
/gene_synonym="mir430c-18"
/note="microRNA 430c-18"
/db_xref="GeneID:100033473"
/db_xref="miRBase:MI0002098"
/db_xref="ZFIN:ZDB-MIRNAG-090929-230"
precursor_RNA 1..73
/gene="dre-mir-430c-18"
/gene_synonym="mir430c-18"
/product="microRNA 430c-18"
/db_xref="GeneID:100033473"
/db_xref="miRBase:MI0002098"
/db_xref="ZFIN:ZDB-MIRNAG-090929-230"
exon 1..73
/gene="dre-mir-430c-18"
/gene_synonym="mir430c-18"
/inference="alignment:Splign:2.1.0"
ncRNA 9..29
/ncRNA_class="miRNA"
/gene="dre-mir-430c-18"
/gene_synonym="mir430c-18"
/product="dre-miR-430c-5p"
/db_xref="miRBase:MIMAT0031929"
/db_xref="GeneID:100033473"
/db_xref="miRBase:MI0002098"
/db_xref="ZFIN:ZDB-MIRNAG-090929-230"
ncRNA 45..66
/ncRNA_class="miRNA"
/gene="dre-mir-430c-18"
/gene_synonym="mir430c-18"
/product="dre-miR-430c-3p"
/db_xref="miRBase:MIMAT0001425"
/db_xref="GeneID:100033473"
/db_xref="miRBase:MI0002098"
/db_xref="ZFIN:ZDB-MIRNAG-090929-230"
ORIGIN
attaagatcacttcaaacaggagcattgatttgtcctttgttcataagtgcttctctttggggtagttttaat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]