GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-14 00:43:32, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       NR_030000                 84 bp    RNA     linear   VRT 05-JUN-2025
DEFINITION  Danio rerio microRNA 9-7 (mir9-7), microRNA.
ACCESSION   NR_030000 NR_039107
VERSION     NR_030000.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 84)
  AUTHORS   Soto,X., Burton,J., Manning,C.S., Minchington,T., Lea,R., Lee,J.,
            Kursawe,J., Rattray,M. and Papalopulu,N.
  TITLE     Sequential and additive expression of miR-9 precursors control
            timing of neurogenesis
  JOURNAL   Development 149 (19) (2022)
   PUBMED   36189829
REFERENCE   2  (bases 1 to 84)
  AUTHORS   Katz,S., Cussigh,D., Urban,N., Blomfield,I., Guillemot,F.,
            Bally-Cuif,L. and Coolen,M.
  TITLE     A Nuclear Role for miR-9 and Argonaute Proteins in Balancing
            Quiescent and Activated Neural Stem Cell States
  JOURNAL   Cell Rep 17 (5), 1383-1398 (2016)
   PUBMED   27783951
REFERENCE   3  (bases 1 to 84)
  AUTHORS   King,B.L. and Yin,V.P.
  TITLE     A Conserved MicroRNA Regulatory Circuit Is Differentially
            Controlled during Limb/Appendage Regeneration
  JOURNAL   PLoS One 11 (6), e0157106 (2016)
   PUBMED   27355827
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 84)
  AUTHORS   Nepal,C., Coolen,M., Hadzhiev,Y., Cussigh,D., Mydel,P., Steen,V.M.,
            Carninci,P., Andersen,J.B., Bally-Cuif,L., Muller,F. and Lenhard,B.
  TITLE     Transcriptional, post-transcriptional and chromatin-associated
            regulation of pri-miRNAs, pre-miRNAs and moRNAs
  JOURNAL   Nucleic Acids Res 44 (7), 3070-3081 (2016)
   PUBMED   26673698
REFERENCE   5  (bases 1 to 84)
  AUTHORS   Desvignes,T., Beam,M.J., Batzel,P., Sydes,J. and Postlethwait,J.H.
  TITLE     Expanding the annotation of zebrafish microRNAs based on small RNA
            sequencing
  JOURNAL   Gene 546 (2), 386-389 (2014)
   PUBMED   24835514
REFERENCE   6  (bases 1 to 84)
  AUTHORS   Delaloy,C. and Gao,F.B.
  TITLE     microRNA-9 multitasking near organizing centers
  JOURNAL   Nat Neurosci 11 (6), 625-626 (2008)
   PUBMED   18506136
  REMARK    GeneRIF: microRNA-9 regulates multiple processes near the
            organizing centers during early brain development in zebrafish.
REFERENCE   7  (bases 1 to 84)
  AUTHORS   Leucht,C., Stigloher,C., Wizenmann,A., Klafke,R., Folchert,A. and
            Bally-Cuif,L.
  TITLE     MicroRNA-9 directs late organizer activity of the
            midbrain-hindbrain boundary
  JOURNAL   Nat Neurosci 11 (6), 641-648 (2008)
   PUBMED   18454145
  REMARK    GeneRIF: This study suggest microRNA-9 fine-tunes late
            midbrain-hindbrain boundary coherence via its co-regulation of
            patterning.activities and neurogenesis.
REFERENCE   8  (bases 1 to 84)
  AUTHORS   Kapsimali,M., Kloosterman,W.P., de Bruijn,E., Rosa,F.,
            Plasterk,R.H. and Wilson,S.W.
  TITLE     MicroRNAs show a wide diversity of expression profiles in the
            developing and mature central nervous system
  JOURNAL   Genome Biol 8 (8), R173 (2007)
   PUBMED   17711588
REFERENCE   9  (bases 1 to 84)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   10 (bases 1 to 84)
  AUTHORS   Chen,P.Y., Manninga,H., Slanchev,K., Chien,M., Russo,J.J., Ju,J.,
            Sheridan,R., John,B., Marks,D.S., Gaidatzis,D., Sander,C.,
            Zavolan,M. and Tuschl,T.
  TITLE     The developmental miRNA profiles of zebrafish as determined by
            small RNA cloning
  JOURNAL   Genes Dev 19 (11), 1288-1293 (2005)
   PUBMED   15937218
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JBMGRA010000002.1.
            
            On Sep 3, 2011 this sequence version replaced NR_039107.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM609100.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-84                JBMGRA010000002.1  60772886-60772969
FEATURES             Location/Qualifiers
     source          1..84
                     /organism="Danio rerio"
                     /mol_type="transcribed RNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="2"
                     /map="2"
     gene            1..84
                     /gene="mir9-7"
                     /gene_synonym="dre-mir-9-7"
                     /note="microRNA 9-7"
                     /db_xref="GeneID:100033559"
                     /db_xref="miRBase:MI0001886"
                     /db_xref="ZFIN:ZDB-MIRNAG-081013-5"
     precursor_RNA   1..84
                     /gene="mir9-7"
                     /gene_synonym="dre-mir-9-7"
                     /product="microRNA 9-7"
                     /db_xref="GeneID:100033559"
                     /db_xref="miRBase:MI0001886"
                     /db_xref="ZFIN:ZDB-MIRNAG-081013-5"
     exon            1..84
                     /gene="mir9-7"
                     /gene_synonym="dre-mir-9-7"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           14..36
                     /ncRNA_class="miRNA"
                     /gene="mir9-7"
                     /gene_synonym="dre-mir-9-7"
                     /product="dre-miR-9-5p"
                     /db_xref="miRBase:MIMAT0001769"
                     /db_xref="GeneID:100033559"
                     /db_xref="miRBase:MI0001886"
                     /db_xref="ZFIN:ZDB-MIRNAG-081013-5"
     ncRNA           51..72
                     /ncRNA_class="miRNA"
                     /gene="mir9-7"
                     /gene_synonym="dre-mir-9-7"
                     /product="dre-miR-9-7-3p"
                     /db_xref="miRBase:MIMAT0031933"
                     /db_xref="GeneID:100033559"
                     /db_xref="miRBase:MI0001886"
                     /db_xref="ZFIN:ZDB-MIRNAG-081013-5"
ORIGIN      
gggttagtttttctctttggttatctagctgtatgagttatgaaatatcataaagctagagaaccgaaagtagaaactatacct
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]