GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-06-08 05:42:04, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_131340               2198 bp    mRNA    linear   VRT 25-FEB-2025
DEFINITION  Danio rerio thyroid hormone receptor beta (thrb), mRNA.
ACCESSION   NM_131340 XM_687890
VERSION     NM_131340.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 2198)
  AUTHORS   Xu,Y., Zhang,S., Bao,Y., Luan,J., Fu,Z., Sun,M., Zhao,X. and
            Feng,X.
  TITLE     Melatonin protects zebrafish pancreatic development and
            physiological rhythms from sodium propionate-induced disturbances
            via the hypothalamic-pituitary-thyroid axis
  JOURNAL   J Sci Food Agric 104 (12), 7454-7463 (2024)
   PUBMED   38717324
REFERENCE   2  (bases 1 to 2198)
  AUTHORS   Fagundes,T., Pannetier,P., Golz,L., Behnstedt,L., Morthorst,J.,
            Vergauwen,L., Knapen,D., Holbech,H., Braunbeck,T. and Baumann,L.
  TITLE     The generation gap in endocrine disruption: Can the integrated fish
            endocrine disruptor test (iFEDT) bridge the gap by assessing
            intergenerational effects of thyroid hormone system disruption?
  JOURNAL   Aquat Toxicol 272, 106969 (2024)
   PUBMED   38824743
REFERENCE   3  (bases 1 to 2198)
  AUTHORS   Ai,N., Han,C.R., Zhao,H., Cheng,S.Y. and Ge,W.
  TITLE     Disruption of Thyroid Hormone Receptor Thrab Leads to Female
            Infertility in Zebrafish
  JOURNAL   Endocrinology 165 (5) (2024)
   PUBMED   38527850
REFERENCE   4  (bases 1 to 2198)
  AUTHORS   Yang,L., Tu,P.H., Zhang,C.X., Xie,R.R., Dong,M., Jing,Y., Chen,X.,
            Wei,G. and Song,H.D.
  TITLE     Influence of two anti-tumor drugs, pazopanib, and axitinib, on the
            development and thyroid-axis of zebrafish (Danio rerio)
            embryos/larvae
  JOURNAL   Front Endocrinol (Lausanne) 14, 1204678 (2023)
   PUBMED   37600710
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 2198)
  AUTHORS   Harper,M., Hu,Y., Donahue,J., Acosta,B., Dievenich Braes,F.,
            Nguyen,S., Zeng,J., Barbaro,J., Lee,H., Bui,H. and McMenamin,S.K.
  TITLE     Thyroid hormone regulates proximodistal patterning in fin rays
  JOURNAL   Proc Natl Acad Sci U S A 120 (21), e2219770120 (2023)
   PUBMED   37186843
REFERENCE   6  (bases 1 to 2198)
  AUTHORS   Takayama,S., Hostick,U., Haendel,M., Eisen,J. and Darimont,B.
  TITLE     An F-domain introduced by alternative splicing regulates activity
            of the zebrafish thyroid hormone receptor alpha
  JOURNAL   Gen Comp Endocrinol 155 (1), 176-189 (2008)
   PUBMED   17583703
REFERENCE   7  (bases 1 to 2198)
  AUTHORS   Walpita,C.N., Van der Geyten,S., Rurangwa,E. and Darras,V.M.
  TITLE     The effect of 3,5,3'-triiodothyronine supplementation on zebrafish
            (Danio rerio) embryonic development and expression of iodothyronine
            deiodinases and thyroid hormone receptors
  JOURNAL   Gen Comp Endocrinol 152 (2-3), 206-214 (2007)
   PUBMED   17418841
REFERENCE   8  (bases 1 to 2198)
  AUTHORS   Krasowski,M.D., Yasuda,K., Hagey,L.R. and Schuetz,E.G.
  TITLE     Evolutionary selection across the nuclear hormone receptor
            superfamily with a focus on the NR1I subfamily (vitamin D, pregnane
            X, and constitutive androstane receptors)
  JOURNAL   Nucl Recept 3, 2 (2005)
   PUBMED   16197547
  REMARK    Publication Status: Online-Only
REFERENCE   9  (bases 1 to 2198)
  AUTHORS   Liu,Y.W. and Chan,W.K.
  TITLE     Thyroid hormones are important for embryonic to larval transitory
            phase in zebrafish
  JOURNAL   Differentiation 70 (1), 36-45 (2002)
   PUBMED   11963654
  REMARK    GeneRIF: Data suggest that the embryonic to larval transitory phase
            is characterized by its dependency on the timely synthesis of
            thyroid hormone and the concomitant autoinductive increase in
            thyroid hormone receptor beta mRNA levels.
REFERENCE   10 (bases 1 to 2198)
  AUTHORS   Marchand,O., Safi,R., Escriva,H., Van Rompaey,E., Prunet,P. and
            Laudet,V.
  TITLE     Molecular cloning and characterization of thyroid hormone receptors
            in teleost fish
  JOURNAL   J Mol Endocrinol 26 (1), 51-65 (2001)
   PUBMED   11174854
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF109732.1.
            
            On Jul 6, 2005 this sequence version replaced XM_687890.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF109732.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA3505370,
                                           SAMEA3505371 [ECO:0006172]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..2198
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /db_xref="taxon:7955"
                     /chromosome="19"
                     /map="19"
     gene            1..2198
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /note="thyroid hormone receptor beta"
                     /db_xref="GeneID:30607"
                     /db_xref="ZFIN:ZDB-GENE-990415-268"
     exon            1..147
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /inference="alignment:Splign:2.1.0"
     exon            148..192
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /inference="alignment:Splign:2.1.0"
     exon            193..255
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /inference="alignment:Splign:2.1.0"
     exon            256..307
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /inference="alignment:Splign:2.1.0"
     exon            308..372
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    345..347
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /note="upstream in-frame stop codon"
     CDS             366..1526
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /note="TRbeta1; nuclear receptor subfamily 1 group A
                     member 2; thyroid hormone receptor beta-1; thyroid hormone
                     receptor beta 2"
                     /codon_start=1
                     /product="thyroid hormone receptor beta"
                     /protein_id="NP_571415.1"
                     /db_xref="GeneID:30607"
                     /db_xref="ZFIN:ZDB-GENE-990415-268"
                     /translation="
MSEQADKCNSRWKDEAMQNGYIPSYLDKDELCVVCGDKATGYHYRCITCEGCKGFFRRTIQKNLNPTYACKYEGKCVIDKVTRNQCQECRFKKCIAVGMATDLVLDDSKRLAKRKLIEENRERRRREELQKTVWDRPEPTQEEWEMIRVVTEAHMATNAQGNHWKQKRKFLPEDIGSAPIVNAPEGNKVDIEAFSQFTKIITPAITRVVDFAKKLPMFCELPCEDQIILLKGCCMEIMSLRAAVRYDPESDTLTLNGEMAVTRGQLKNGGLGVVSDAIFDLGVSLSSFNLDDSEVALLQAVILLSSDRPGLTSVERIERCQEEFLLAFEHYINYRKHKVAHFWPKLLMKVTDLRMIGACHASRFLHMKVECPTELFPPLFLEVFED"
     misc_feature    456..716
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /note="DNA-binding domain of thyroid hormone receptors
                     (TRs) is composed of two C4-type zinc fingers; Region:
                     NR_DBD_TR; cd06961"
                     /db_xref="CDD:143519"
     misc_feature    order(459..461,468..470,510..512,519..521,573..575,
                     591..593,621..623,630..632)
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /note="zinc binding site [ion binding]; other site"
                     /db_xref="CDD:143519"
     misc_feature    order(489..497,513..518,522..524,528..530,534..539,
                     546..548,612..617,624..626,633..635,672..680,693..695,
                     702..707,711..716)
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143519"
     misc_feature    order(489..491,498..500,663..665,669..674)
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /note="heterodimer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:143519"
     misc_feature    786..1514
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /note="The ligand binding domain of thyroid hormone
                     receptor, a members of a superfamily of nuclear receptors;
                     Region: NR_LBD_TR; cd06935"
                     /db_xref="CDD:132733"
     misc_feature    order(945..947,954..959,963..968,975..977,984..986,
                     1068..1070,1077..1079,1089..1091,1125..1133,1161..1163,
                     1170..1172,1176..1178,1197..1199,1443..1445,1464..1466,
                     1503..1505)
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:132733"
     misc_feature    order(981..983,990..992,1002..1004,1032..1034,1044..1046,
                     1053..1055,1497..1502,1509..1511)
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /note="coactivator recognition site [polypeptide binding];
                     other site"
                     /db_xref="CDD:132733"
     misc_feature    order(1182..1184,1317..1319,1407..1409,1416..1421,
                     1428..1430,1437..1442,1446..1451)
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:132733"
     exon            373..423
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /inference="alignment:Splign:2.1.0"
     exon            424..524
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /inference="alignment:Splign:2.1.0"
     exon            525..672
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /inference="alignment:Splign:2.1.0"
     exon            673..878
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /inference="alignment:Splign:2.1.0"
     exon            879..1025
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /inference="alignment:Splign:2.1.0"
     exon            1026..1284
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /inference="alignment:Splign:2.1.0"
     exon            1285..2198
                     /gene="thrb"
                     /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1;
                     wu:fj24f03"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
cttctttctgtgtcttcgggtccatgttggagttgatctgctctgctgggtcatttcaggccacgtatgtccgatcacaggagcaaacattaaagttacagagatatcaatgaaggacatacacacatgctgtgttgcagcttcgagggtctctcatctgaatgaatgcattgcccatgaagtcagcgatggggcgttgcaagaggggctctggctcttatgacatggtttagaggatgaaaggcaggatgtaaggctctgcttcttcataccactctgggacaacttcaaaatcacaaagcacgagatatcagcgagtctgtggacaacaaaagaatgatggttaaggcctaatatactgcagtatgtcagagcaagcagacaaatgcaactcccgctggaaagatgaggccatgcagaatgggtacataccaagttacctggacaaggatgagctgtgtgttgtttgtggagacaaagcaactggttatcactatcgctgcattacatgtgagggctgcaaaggtttctttcgacgcacaattcagaagaacttaaacccaacatacgcatgcaagtatgaaggaaagtgtgtcattgacaaagttacccgaaaccagtgccaagaatgtcgcttcaagaaatgcatcgctgttggcatggctacagacttggtattggatgacagtaaacgtttagccaagcggaagctgattgaggagaaccgtgaacgccgacggcgtgaggagctgcagaagactgtatgggatcgaccagagcccacacaggaagagtgggagatgatacgggttgtcacagaggcccatatggccacaaatgcccaaggcaaccactggaaacaaaagcgcaaattcctgccagaagacattggatcggcacctattgtcaatgcaccagaggggaacaaagtggacattgaagccttcagtcagtttacaaaaattatcacccccgccatcactcgtgtcgtggattttgccaaaaagctacccatgttctgtgagctgccttgtgaggaccagatcattttgctgaagggttgttgcatggagatcatgtctcttcgagcagcagtgcgttatgaccccgagagcgatactctgacgctaaacggggagatggctgtcacacggggccagctcaagaatgggggtttgggtgttgtctcagatgccatctttgatctgggtgtctcgctgtcctcttttaacttggacgattcagaggtggcgttgttacaagccgtgattctgctttcctctgatcgtccaggtttaacaagcgttgagcggatagagcgttgtcaggaggagtttcttttggcctttgaacattacatcaactaccgtaagcacaaggtggctcacttttggcccaaactgctgatgaaggtgacagacctgcgcatgattggtgcctgccatgccagccgcttcctgcacatgaaggtggaatgtcccacagagctctttccgcccctcttcctggaagtgtttgaagactgatggcaatccaatcaggccaagctgctcccaccaacaccaacctccacaaatcagacctctacagtctccctgttcctggtcatatgtttctagcactactgaacatcatttcattccatagagttaggagtagctctggggcctatttgatgggatccattccttttacaaagcgggtacatttgaatagcataaaaaaataaattctgttactattgttttgttttttcagaaatgtttgatatctggtcatagtgttggataccgctcaacagaaatgtatgaactatgcattcaggtttcatgtcacatcaggcctcagaaataagtcaaatagcgccacactgcaaaggataatagcaatattttgtttcaatttacgtccttattctattggtctataggtctttttaagcttatgttaagctataggttgtttattgttttgttccagaaccctgtaaagcacttacagtacctagaccgaatttcattacatcaataggcgcaaagtaaaatcacaattgtgggctatattattacaatacttttgtcctagacaaaatcactaaatggaaaatgcatttatacttgtaactttaatttgcatagtttaggagcagtaccacaaaaatagatcttagactctttattgtctcaggtttgtcagaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]