GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-23 05:14:58, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XM_018813577            2050 bp    mRNA    linear   INV 22-OCT-2018
DEFINITION  PREDICTED: Ciona intestinalis transcription factor protein (meis),
            transcript variant X3, mRNA.
ACCESSION   XM_018813577
VERSION     XM_018813577.2
DBLINK      BioProject: PRJNA187185
KEYWORDS    RefSeq.
SOURCE      Ciona intestinalis (vase tunicate)
  ORGANISM  Ciona intestinalis
            Eukaryota; Metazoa; Chordata; Tunicata; Ascidiacea; Phlebobranchia;
            Cionidae; Ciona.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_020175.2) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Oct 22, 2018 this sequence version replaced XM_018813577.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Ciona intestinalis Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2050
                     /organism="Ciona intestinalis"
                     /mol_type="mRNA"
                     /db_xref="taxon:7719"
                     /chromosome="10"
     gene            1..2050
                     /gene="meis"
                     /note="transcription factor protein; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 22
                     ESTs, 1 Protein, and 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 63 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:778904"
     CDS             140..1801
                     /gene="meis"
                     /codon_start=1
                     /product="transcription factor protein isoform X3"
                     /protein_id="XP_018669122.1"
                     /db_xref="GeneID:778904"
                     /translation="
MSQQFDDGMAHFGGMNDLRDMSQPSSGAGGLYGGDLNRSIPQLGHLSHGHSSMSHFSASTPGSAHPMSTMHATQSSGSSTSMDERLSDSERVNLKGDKDAIYSHPLFPLLALVFEKCELATCTPRDPGVTGGDVCSSDSFNDDIACFAKQIHSENRPITFDPNNEIDNLMILSIQVLRFHLLELEKVHELCQNFTSRYINCLKGKMPIDLVIEDREGGVPSKLEANEPTSSGSEQSFYNQETPSHPSMDTNAMHAGNMGGGGPVAIPAQSSSHHHLHTPSTHQHQQQHHHNADSSPTGSTIEGSTYSGEGGNEDDSDPGKKPQQKKRGIFPKQATNIMRAWLFQNLTHPYPTEEQKKSLANQTGLTILQVNNWFINARRRIVQPMIDQSNRAVSNAMGPYSPDGQSMGGFLCMDGQPPHMAMRHPGWPSGFQSMPGAADMMAAQHISMAAANSSFNPTSTMSPSHHPSGLHHQLRHPPSQAMLLPGSHQHHHAAAAAAAMMMPHHAAAVAAAAGHSAVTGMGHHPHHGHHLHHSGQSTMNPADMSSHMLGHTC"
     misc_feature    530..790
                     /gene="meis"
                     /note="N-terminal of Homeobox Meis and PKNOX1; Region:
                     Meis_PKNOX_N; pfam16493"
                     /db_xref="CDD:465140"
     misc_feature    order(1112..1123,1127..1129,1187..1189,1205..1207,
                     1244..1246,1250..1255,1262..1267,1271..1279)
                     /gene="meis"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(1115..1117,1124..1126,1253..1255,1262..1267,
                     1274..1276)
                     /gene="meis"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    1163..1279
                     /gene="meis"
                     /note="Homeobox KN domain; Region: Homeobox_KN; pfam05920"
                     /db_xref="CDD:428673"
ORIGIN      
aggttttaggatatttaggcaataaagtttatgtactatacccactgtatatttggacgatttgtgtcgaaatactttttgggaaatactgtctctactgaaaacttatttggagtaaattcaaagaaagaaaagaaaaatgtcgcaacagtttgacgacggaatggcgcacttcggcggcatgaacgacctaagagatatgagccaaccgtcatcgggcgcgggcggactgtacggcggggatttgaaccgctcgatcccgcagctcgggcatctttcgcacgggcactcgtcgatgtcacatttctcagcgagtacacctggatctgcacatccaatgtcaactatgcatgcgacgcagtcgtcaggttcatctacgagtatggacgaaagattaagcgactcggaacgcgtcaatctgaagggagacaaggacgccatttattcacaccccctgttcccgctgctggctctggtcttcgaaaaatgtgagctagcgacctgtacaccacgtgaccccggcgtaacaggcggtgacgtatgctcttccgattcattcaacgacgacattgcgtgttttgctaagcagattcattccgaaaaccgaccaatcaccttcgaccccaacaacgaaatcgacaacctgatgatcctgtctattcaggttctgcgtttccacctgcttgagttagaaaaggttcacgaactttgtcagaacttcacatcaaggtatattaactgcctaaaaggaaaaatgcccattgacctggtcatagaggatcgggaagggggagtcccctcgaaactggaagcgaatgagccgacctcatcaggctccgaacaatcattctataaccaagaaacaccttcccaccctagtatggatacaaacgctatgcacgcgggtaacatgggcggtggggggcctgtggcaataccagcacagtcgtcatcccatcaccacctacatacaccgtcaacacatcagcaccaacagcaacatcaccataacgcggactccagtccaacaggaagcaccatagaagggagtacatactccggggaaggaggtaacgaagatgattccgatcccggcaagaaaccccagcagaagaaaagaggaatcttcccaaaacaagcgactaatattatgagagcttggctttttcaaaacttaacgcacccttacccaaccgaagaacaaaagaaatctttagctaaccaaaccgggcttacgatactgcaagtgaacaactggttcattaacgcgagacggagaatagtccaaccgatgatcgaccaatccaatagagcagtgagcaatgctatgggaccatacagccctgatggtcaatctatgggcggcttcttatgcatggacggacagccaccgcacatggcaatgcgtcacccaggatggccgtcaggtttccaaagcatgcctggcgcagctgatatgatggcagcacagcatatatcaatggcagctgcaaacagctcattcaacccgacctccactatgtcaccttcacaccacccttcaggacttcatcaccaacttcgacaccccccctcacaggccatgctgcttcccgggtctcaccagcaccaccacgcggcagccgcagcagcagcaatgatgatgccacaccatgcagcggcggtggctgcggccgctggacacagcgcagtaacaggcatgggccaccacccgcaccacggccaccacctacaccattcaggccaatctacgatgaatccagcggacatgtcgtctcatatgctcggccatacttgctagcaaagtctccttaaatccgagcggtagctcgtgagcaaacgttggagttaacgcgcggatgaactccatccagacagcgcgtaccacgggcggattgcacctaagggatggctacccgcctcgtgacaaccaatggttccagtcagtttgctacctcttattagcgttcgaccacgagagcgctgctcacaaagagtgttcgtcttttcggtcaaaccacgtgacccggcgtcaccggcgcaacgtgcc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]