GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-06-25 14:52:00, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       NM_120754               1639 bp    mRNA    linear   PLN 20-OCT-2022
DEFINITION  Arabidopsis thaliana homeobox leucine zipper protein (HAT14), mRNA.
ACCESSION   NM_120754
VERSION     NM_120754.5
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 1639)
  AUTHORS   Tabata,S., Kaneko,T., Nakamura,Y., Kotani,H., Kato,T., Asamizu,E.,
            Miyajima,N., Sasamoto,S., Kimura,T., Hosouchi,T., Kawashima,K.,
            Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S.,
            Nakazaki,N., Naruo,K., Okumura,S., Shinpo,S., Takeuchi,C., Wada,T.,
            Watanabe,A., Yamada,M., Yasuda,M., Sato,S., de la Bastide,M.,
            Huang,E., Spiegel,L., Gnoj,L., O'Shaughnessy,A., Preston,R.,
            Habermann,K., Murray,J., Johnson,D., Rohlfing,T., Nelson,J.,
            Stoneking,T., Pepin,K., Spieth,J., Sekhon,M., Armstrong,J.,
            Becker,M., Belter,E., Cordum,H., Cordes,M., Courtney,L.,
            Courtney,W., Dante,M., Du,H., Edwards,J., Fryman,J., Haakensen,B.,
            Lamar,E., Latreille,P., Leonard,S., Meyer,R., Mulvaney,E.,
            Ozersky,P., Riley,A., Strowmatt,C., Wagner-McPherson,C., Wollam,A.,
            Yoakum,M., Bell,M., Dedhia,N., Parnell,L., Shah,R., Rodriguez,M.,
            See,L.H., Vil,D., Baker,J., Kirchoff,K., Toth,K., King,L.,
            Bahret,A., Miller,B., Marra,M., Martienssen,R., McCombie,W.R.,
            Wilson,R.K., Murphy,G., Bancroft,I., Volckaert,G., Wambutt,R.,
            Dusterhoft,A., Stiekema,W., Pohl,T., Entian,K.D., Terryn,N.,
            Hartley,N., Bent,E., Johnson,S., Langham,S.A., McCullagh,B.,
            Robben,J., Grymonprez,B., Zimmermann,W., Ramsperger,U., Wedler,H.,
            Balke,K., Wedler,E., Peters,S., van Staveren,M., Dirkse,W.,
            Mooijman,P., Lankhorst,R.K., Weitzenegger,T., Bothe,G., Rose,M.,
            Hauf,J., Berneiser,S., Hempel,S., Feldpausch,M., Lamberth,S.,
            Villarroel,R., Gielen,J., Ardiles,W., Bents,O., Lemcke,K.,
            Kolesov,G., Mayer,K., Rudd,S., Schoof,H., Schueller,C.,
            Zaccaria,P., Mewes,H.W., Bevan,M. and Fransz,P.
  CONSRTM   Kazusa DNA Research Institute; Cold Spring Harbor and Washington
            University in St Louis Sequencing Consortium; European Union
            Arabidopsis Genome Sequencing Consortium
  TITLE     Sequence and analysis of chromosome 5 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 823-826 (2000)
   PUBMED   11130714
REFERENCE   2  (bases 1 to 1639)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (19-OCT-2022) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1639)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 1639)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003076).
            
            On Sep 12, 2016 this sequence version replaced NM_120754.4.
FEATURES             Location/Qualifiers
     source          1..1639
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="5"
                     /ecotype="Columbia"
     gene            1..1639
                     /gene="HAT14"
                     /locus_tag="AT5G06710"
                     /gene_synonym="homeobox from Arabidopsis thaliana;
                     MPH15.6; MPH15_6"
                     /note="Homeobox-leucine zipper protein."
                     /db_xref="Araport:AT5G06710"
                     /db_xref="GeneID:830560"
                     /db_xref="TAIR:AT5G06710"
     CDS             283..1293
                     /gene="HAT14"
                     /locus_tag="AT5G06710"
                     /gene_synonym="homeobox from Arabidopsis thaliana;
                     MPH15.6; MPH15_6"
                     /inference="Similar to RNA sequence,
                     EST:INSD:BP570035.1,INSD:DR297346.1,INSD:BP566875.1,
                     INSD:DR297347.1,INSD:DR751693.1,INSD:DR297345.1,
                     INSD:BP568822.1,INSD:BP643286.1,INSD:AU235388.1,
                     INSD:AU226069.1,INSD:DR380480.1,INSD:DR751694.1,
                     INSD:BP566857.1,INSD:BP582658.1"
                     /inference="similar to RNA sequence,
                     mRNA:INSD:AK227423.1,INSD:U09334.1,INSD:BT005879.1,
                     INSD:BX831576.1,INSD:AJ431182.1"
                     /note="homeobox from Arabidopsis thaliana (HAT14);
                     FUNCTIONS IN: DNA binding, sequence-specific DNA binding
                     transcription factor activity; INVOLVED IN: regulation of
                     transcription, DNA-dependent, regulation of transcription;
                     LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures;
                     EXPRESSED DURING: 9 growth stages; CONTAINS InterPro
                     DOMAIN/s: Homeobox, conserved site (InterPro:IPR017970),
                     Homeobox (InterPro:IPR001356), Homeodomain-like
                     (InterPro:IPR009057), Leucine zipper, homeobox-associated
                     (InterPro:IPR003106), Homeodomain-related
                     (InterPro:IPR012287); BEST Arabidopsis thaliana protein
                     match is: Homeobox-leucine zipper protein family
                     (TAIR:AT4G37790.1); Has 30201 Blast hits to 17322 proteins
                     in 780 species: Archae - 12; Bacteria - 1396; Metazoa -
                     17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other
                     Eukaryotes - 2996 (source: NCBI BLink)."
                     /codon_start=1
                     /product="homeobox leucine zipper protein"
                     /protein_id="NP_196289.2"
                     /db_xref="GeneID:830560"
                     /db_xref="TAIR:AT5G06710"
                     /db_xref="Araport:AT5G06710"
                     /translation="
MELALSLGDNTKKQFSFMEKNSKINNPSVSSTSTSEKDLGFCMALDVAFGGHRSLSSSSSPSVEDEKKKPAPRAKKSDEFRVSSSVDPPLQLQLHFPNWLPENSKGRQGGRMPLGAATVVEEEEEEEEAVPSMSVSPPDSVTSSFQLDFGIKSYGYERRSNKRDIDDEVERSASRASNEDNDDENGSTRKKLRLSKDQSAFLEDSFKEHSTLNPKQKIALAKQLNLRPRQVEVWFQNRRARTKLKQTEVDCEYLKRCCESLTEENRRLQKEVKELRTLKTSTPFYMQLPATTLTMCPSCERVATSAAQPSTSAAHNLCLSTSSLIPVKPRPAKQVS"
     misc_feature    841..1011
                     /gene="HAT14"
                     /locus_tag="AT5G06710"
                     /gene_synonym="homeobox from Arabidopsis thaliana;
                     MPH15.6; MPH15_6"
                     /note="Homeodomain; Region: HOX; smart00389"
                     /db_xref="CDD:197696"
     misc_feature    order(847..858,862..864,913..915,931..933,970..972,
                     976..981,988..993,997..1005,1009..1014)
                     /gene="HAT14"
                     /locus_tag="AT5G06710"
                     /gene_synonym="homeobox from Arabidopsis thaliana;
                     MPH15.6; MPH15_6"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(850..852,859..861,979..981,988..993,1000..1002)
                     /gene="HAT14"
                     /locus_tag="AT5G06710"
                     /gene_synonym="homeobox from Arabidopsis thaliana;
                     MPH15.6; MPH15_6"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    1015..1146
                     /gene="HAT14"
                     /locus_tag="AT5G06710"
                     /gene_synonym="homeobox from Arabidopsis thaliana;
                     MPH15.6; MPH15_6"
                     /note="homeobox associated leucin zipper; Region: HALZ;
                     smart00340"
                     /db_xref="CDD:128634"
ORIGIN      
cattgttcacatatattaaaaaatatataattacataaatacatgccctattcatataccactaaaaagaatgatgacttaaatcacatgtcttaaggaatttataggatgaagatccaatatttgttcatatacataaataatattatttaaatacattgaacataggaaataaataagtggggtttcactttcatgtcaccactccataaggccacaacagatcttcttgttcctctctctcaatctctctctctaaaactcttattttcttcgtaagagatggaactagcgttgtctctaggcgacaatactaagaaacagttctcttttatggagaagaactcgaagattaataatccctctgtctcgtcgacatctacttccgagaaggatcttgggttctgcatggctttagatgttgcttttggtggtcacagatcgttgtcatcctcttcgtctccgtcggtagaggatgagaagaagaaaccggcgcccagagcaaaaaaatctgacgaatttagggtttcgtcttctgtagatccaccattacagcttcagcttcacttccctaattggctccctgagaacagtaaaggtcgacaaggaggaagaatgcccttaggagcagctacggttgtggaggaggaagaggaggaggaggaagcggtgcctagtatgtcagtatcgccgccggatagtgtaacgtcgtcgtttcaattggactttgggattaaaagttatggttatgagagaagaagcaataagagagatattgatgatgaagtggagagatcagcttcaagagccagcaacgaagacaacgatgacgagaatggatccactaggaagaaacttagactctccaaagaccaatctgcttttcttgaagacagcttcaaagaacacagtacccttaatcctaaacagaagattgcattggcgaagcagttgaatcttcgtcctcgtcaggttgaagtctggtttcaaaacagacgagccaggacaaagctgaagcaaacggaagtggactgtgaatacctaaagagatgctgtgagtcactaaccgaagaaaaccggaggcttcaaaaagaggttaaagaattgagaaccttgaagacttccacacccttttacatgcaacttccggccactactctcactatgtgcccttcttgtgaacgtgttgccacttcagcagcacagccctccacgtcagctgcccacaacctctgtttgtccacgtcatcattgattccggttaagcctcggccggccaaacaagtttcatgaaagcacctgcgaaatacagtttgagcaaacggtcgagctagagtggttttaaaagttgtcttcttgtgtatatatttattttacttttcatattttattagagaccgctattttgaaagacgaatagattgattatccggttagtgttttgtttttcttagataggaccggataaaaaacagatggagcaaaagggttgacatgttttattgaatgatagaggaatatagaagaagacaaaaggaaaaggggaaaatatttggtttgatcttatagacttttatttgtgattaaagcaaaagggtttgtcgtgcaaaaaatcttcactagatacgtttaattatcg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]