GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-04 11:48:45, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_120460               1169 bp    mRNA    linear   PLN 20-OCT-2022
DEFINITION  Arabidopsis thaliana homeobox 51 (HB51), mRNA.
ACCESSION   NM_120460
VERSION     NM_120460.5
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 1169)
  AUTHORS   Tabata,S., Kaneko,T., Nakamura,Y., Kotani,H., Kato,T., Asamizu,E.,
            Miyajima,N., Sasamoto,S., Kimura,T., Hosouchi,T., Kawashima,K.,
            Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S.,
            Nakazaki,N., Naruo,K., Okumura,S., Shinpo,S., Takeuchi,C., Wada,T.,
            Watanabe,A., Yamada,M., Yasuda,M., Sato,S., de la Bastide,M.,
            Huang,E., Spiegel,L., Gnoj,L., O'Shaughnessy,A., Preston,R.,
            Habermann,K., Murray,J., Johnson,D., Rohlfing,T., Nelson,J.,
            Stoneking,T., Pepin,K., Spieth,J., Sekhon,M., Armstrong,J.,
            Becker,M., Belter,E., Cordum,H., Cordes,M., Courtney,L.,
            Courtney,W., Dante,M., Du,H., Edwards,J., Fryman,J., Haakensen,B.,
            Lamar,E., Latreille,P., Leonard,S., Meyer,R., Mulvaney,E.,
            Ozersky,P., Riley,A., Strowmatt,C., Wagner-McPherson,C., Wollam,A.,
            Yoakum,M., Bell,M., Dedhia,N., Parnell,L., Shah,R., Rodriguez,M.,
            See,L.H., Vil,D., Baker,J., Kirchoff,K., Toth,K., King,L.,
            Bahret,A., Miller,B., Marra,M., Martienssen,R., McCombie,W.R.,
            Wilson,R.K., Murphy,G., Bancroft,I., Volckaert,G., Wambutt,R.,
            Dusterhoft,A., Stiekema,W., Pohl,T., Entian,K.D., Terryn,N.,
            Hartley,N., Bent,E., Johnson,S., Langham,S.A., McCullagh,B.,
            Robben,J., Grymonprez,B., Zimmermann,W., Ramsperger,U., Wedler,H.,
            Balke,K., Wedler,E., Peters,S., van Staveren,M., Dirkse,W.,
            Mooijman,P., Lankhorst,R.K., Weitzenegger,T., Bothe,G., Rose,M.,
            Hauf,J., Berneiser,S., Hempel,S., Feldpausch,M., Lamberth,S.,
            Villarroel,R., Gielen,J., Ardiles,W., Bents,O., Lemcke,K.,
            Kolesov,G., Mayer,K., Rudd,S., Schoof,H., Schueller,C.,
            Zaccaria,P., Mewes,H.W., Bevan,M. and Fransz,P.
  CONSRTM   Kazusa DNA Research Institute; Cold Spring Harbor and Washington
            University in St Louis Sequencing Consortium; European Union
            Arabidopsis Genome Sequencing Consortium
  TITLE     Sequence and analysis of chromosome 5 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 823-826 (2000)
   PUBMED   11130714
REFERENCE   2  (bases 1 to 1169)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (19-OCT-2022) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1169)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 1169)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003076).
            
            On Sep 12, 2016 this sequence version replaced NM_120460.4.
FEATURES             Location/Qualifiers
     source          1..1169
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="5"
                     /ecotype="Columbia"
     gene            1..1169
                     /gene="HB51"
                     /locus_tag="AT5G03790"
                     /gene_synonym="ATHB51; homeobox 51; LATE MERISTEM
                     IDENTITY1; LMI1"
                     /note="Encodes a homeodomain leucine zipper class I
                     (HD-Zip I) meristem identity regulator that acts together
                     with LFY to induce CAL expression. It binds to the CAL
                     promoter proximal CAATNATTG element. LMI1 acts primarily
                     downstream of LFY in meristem identity regulation. The
                     interaction between LFY, LMI1 and CAL resembles a
                     feed-forward loop transcriptional network motif. The gene
                     also had additional LFY-independent roles in leaf
                     morphogenesis and bract formation."
                     /db_xref="Araport:AT5G03790"
                     /db_xref="GeneID:831723"
                     /db_xref="TAIR:AT5G03790"
     CDS             204..911
                     /gene="HB51"
                     /locus_tag="AT5G03790"
                     /gene_synonym="ATHB51; homeobox 51; LATE MERISTEM
                     IDENTITY1; LMI1"
                     /inference="Similar to RNA sequence,
                     EST:INSD:EL982910.1,INSD:DR749928.1,INSD:DR750589.1,
                     INSD:DR750590.1,INSD:ES081691.1"
                     /note="homeobox 51 (HB51); FUNCTIONS IN: sequence-specific
                     DNA binding, DNA binding, sequence-specific DNA binding
                     transcription factor activity; INVOLVED IN: in 6
                     processes; LOCATED IN: nucleus; EXPRESSED IN: 14 plant
                     structures; EXPRESSED DURING: 6 growth stages; CONTAINS
                     InterPro DOMAIN/s: Homeobox, conserved site
                     (InterPro:IPR017970), Homeobox (InterPro:IPR001356),
                     Homeodomain-like (InterPro:IPR009057), Helix-turn-helix
                     motif, lambda-like repressor (InterPro:IPR000047),
                     Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis
                     thaliana protein match is: homeobox protein 22
                     (TAIR:AT2G36610.1); Has 11020 Blast hits to 10992 proteins
                     in 578 species: Archae - 2; Bacteria - 0; Metazoa - 8622;
                     Fungi - 156; Plants - 2028; Viruses - 0; Other Eukaryotes
                     - 212 (source: NCBI BLink)."
                     /codon_start=1
                     /product="homeobox 51"
                     /protein_id="NP_195999.2"
                     /db_xref="GeneID:831723"
                     /db_xref="TAIR:AT5G03790"
                     /db_xref="Araport:AT5G03790"
                     /translation="
MEWSTTSNVENVRVAFMPPPWPESSSFNSLHSFNFDPYAGNSYTPGDTQTGPVISVPESEKIMNAYRFPNNNNEMIKKKRLTSGQLASLERSFQEEIKLDSDRKVKLSRELGLQPRQIAVWFQNRRARWKAKQLEQLYDSLRQEYDVVSREKQMLHDEVKKLRALLRDQGLIKKQISAGTIKVSGEEDTVEISSVVVAHPRTENMNANQITGGNQVYGQYNNPMLVASSGWPSYP"
     misc_feature    432..593
                     /gene="HB51"
                     /locus_tag="AT5G03790"
                     /gene_synonym="ATHB51; homeobox 51; LATE MERISTEM
                     IDENTITY1; LMI1"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    597..701
                     /gene="HB51"
                     /locus_tag="AT5G03790"
                     /gene_synonym="ATHB51; homeobox 51; LATE MERISTEM
                     IDENTITY1; LMI1"
                     /note="Homeobox associated leucine zipper; Region: HALZ;
                     pfam02183"
                     /db_xref="CDD:460477"
ORIGIN      
tccaaaagacaaagtacatagaagaagaaacttcttgtcacgcctctcttaccccttcccttgtggtccaataaaaccctaattttcttttctttcttttatccattgtattagatcctatatctttcttccttatagaccatctctcatgtcttcttatatatattaagatattcacaagaactacaaaagaaagaaaggagatggagtggtcaacaacgagcaacgtagaaaacgtgagagtagctttcatgccaccgccatggccggagtctagttcctttaactcgctccacagcttcaactttgatccttacgcaggaaattcatatacgcctggcgatacacaaaccggaccggttatctctgtaccggaatcagaaaagatcatgaatgcgtaccgatttccgaacaacaacaatgagatgataaaaaagaagagactaacgagtggacaattagcttcacttgagcgaagttttcaagaagagatcaaattagattcagacaggaaggtgaagctgtcgagagagctcggtctgcagccacgtcagatagcagtttggttccaaaaccgccgtgcacggtggaaggcgaagcagcttgagcagttgtacgactcgcttagacaagagtacgacgtcgtttctagggagaaacaaatgttacacgatgaggtgaagaagctgagagctttactaagagaccagggtttgatcaagaagcaaatctctgccgggaccatcaaagtttccggtgaggaagacacggtggagatttcatcggtggtggtagctcatccaagaacggagaatatgaacgcaaatcaaatcaccggagggaatcaagtttacggtcaatacaacaatccgatgctggttgcttcctctggctggccgtcatacccctgatagatgttgctgatctcagagagagggaaagagaatgagagaacgagagaaagagagagagagagattgtgtcaaatagagctttagactaggactttagtagtgttatagactaagacaagctttctctcattgtacgatcttaaaacataaatggcacgttcttggatgcgagattgagtctgaaaattgttgagttggttttgttgaacaactatactatgaacactcagaattggcgaatgtccgaaacaaaac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]