GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-14 13:48:50, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XR_011415201             357 bp    RNA     linear   PLN 05-DEC-2024
DEFINITION  PREDICTED: Nicotiana tomentosiformis uncharacterized lncRNA
            (LOC138908792), ncRNA.
ACCESSION   XR_011415201
VERSION     XR_011415201.1
DBLINK      BioProject: PRJNA257218
KEYWORDS    RefSeq.
SOURCE      Nicotiana tomentosiformis
  ORGANISM  Nicotiana tomentosiformis
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; asterids; lamiids; Solanales; Solanaceae;
            Nicotianoideae; Nicotianeae; Nicotiana.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_090814) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_000390325.3-RS_2024_10
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 10/03/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..357
                     /organism="Nicotiana tomentosiformis"
                     /mol_type="transcribed RNA"
                     /bio_material="USDA:TW 142"
                     /db_xref="taxon:4098"
                     /chromosome="3"
                     /tissue_type="leaf"
     gene            1..357
                     /gene="LOC138908792"
                     /note="uncharacterized LOC138908792; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:138908792"
     ncRNA           1..357
                     /ncRNA_class="lncRNA"
                     /gene="LOC138908792"
                     /product="uncharacterized lncRNA"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
                     /db_xref="GeneID:138908792"
ORIGIN      
gccttcacatgcattaaaaagagaaaatttaaagttcgaaacctttgaagatctagaaagcaaagttctaaaaaagaaacaaaagaaaaaaggggaaatgttatttcaaggaaaaaatttgaaatcaacttgatggcttgcgagttttgagtaccaatctcttcttgggtttctaaaaattgcggaatttgaaaatctattgttgttgtattcatgtattagcttagctccactctctcttcttcttagccttatttagcctcacagctttgtttttaaaatactaggtatgtacacttccagttctttgattgttgctagttcgaatgaatgaaatattgatttgttttggctcca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]