GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-02-01 12:51:49, GGRNA.v2 : RefSeq release 227 (Nov, 2024)

LOCUS       XR_002416247             594 bp    RNA     linear   VRT 08-MAY-2024
DEFINITION  PREDICTED: Columba livia uncharacterized LOC110360386
            (LOC110360386), ncRNA.
ACCESSION   XR_002416247
VERSION     XR_002416247.2
DBLINK      BioProject: PRJNA1106885
KEYWORDS    RefSeq.
SOURCE      Columba livia (rock pigeon)
  ORGANISM  Columba livia
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Columbimorphae;
            Columbiformes; Columbidae; Columba.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_088614) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On May 8, 2024 this sequence version replaced XR_002416247.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_036013475.1-RS_2024_05
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 05/03/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..594
                     /organism="Columba livia"
                     /mol_type="transcribed RNA"
                     /isolate="bColLiv1"
                     /db_xref="taxon:8932"
                     /chromosome="13"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
                     /geo_loc_name="USA: Davis, CA"
                     /lat_lon="38.513750 N 121.754494 W"
                     /collection_date="2023-03-29"
                     /breed="racing homer"
     gene            1..594
                     /gene="LOC110360386"
                     /note="uncharacterized LOC110360386; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:110360386"
     ncRNA           1..594
                     /ncRNA_class="lncRNA"
                     /gene="LOC110360386"
                     /product="uncharacterized LOC110360386"
                     /db_xref="GeneID:110360386"
ORIGIN      
tttcagtgaacgggtttctgacatttttgtcagcagagctggctgcagcagtggaggggagtgtgtgtttcacggcaatctcttcttggattctgaattttatttcatttaacttcatttttaagatgctctttttctggcgtgtgtaaggtgcctggacttacgctgttagcacagcaagctccatttgacatctcgcctgggctctaggatcattgttgcccactatttaaaactgtgattattttcttccttttcatccaccttggctgtaacagtttctacacaatgcagttcagagagttttgtggacaagacagcttatgtcgcatcacttgtgtaagaatgggagtttccatcaccaggagagcagcataaagtactcattcctggagacaaactgtggcacgtcctccaaccctgcagcactgagcagacatacaagttacaaggacatctgcaaatttagatcccatattttgtgccatgttgtgctacttgaaggcaagcggtacaagaaatgtttttgaaggaggattctgtccttcatttcttgtatagaccttcagaagcaagaaaatgacagaaatggac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]