2024-05-01 13:11:46, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_001597393 409 bp RNA linear MAM 28-SEP-2020 DEFINITION PREDICTED: Rousettus aegyptiacus uncharacterized LOC107512815 (LOC107512815), transcript variant X1, ncRNA. ACCESSION XR_001597393 VERSION XR_001597393.2 DBLINK BioProject: PRJNA665208 KEYWORDS RefSeq. SOURCE Rousettus aegyptiacus (Egyptian rousette) ORGANISM Rousettus aegyptiacus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Chiroptera; Megachiroptera; Pteropodidae; Pteropodinae; Rousettus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_023416286.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Sep 28, 2020 this sequence version replaced XR_001597393.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Rousettus aegyptiacus Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..409 /organism="Rousettus aegyptiacus" /mol_type="transcribed RNA" /isolate="mRouAeg1" /db_xref="taxon:9407" /chromosome="Unknown" /sex="male" /tissue_type="muscle" /dev_stage="adult" /country="USA: Berkeley (captive colony)" /collection_date="2017" /collected_by="Sonja Vernes" gene 1..409 /gene="LOC107512815" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:107512815" ncRNA 1..409 /ncRNA_class="lncRNA" /gene="LOC107512815" /product="uncharacterized LOC107512815, transcript variant X1" /db_xref="GeneID:107512815" ORIGIN
cgtcagccggcgctgaactgtgacggcagcgctcacggacccgcggctcgtgacggcattattgggggcgaccatcgacctggatattttttctgcatatgaaaccccgactgacaatctcttcttgcgacgctcgacggtgaagcgccctgttcttccagcagccacggcctctcatgagaagctgctgtcatttaagtgacaacctgcttacaggaaacctctccatgaaagaagaagaaaacaggtttttatcgaataagcagtaaaccagaacgtgacgtgcatccaggcaatccagtgggacatctcacctggacagagccagactggtgcgacctgtcacacacacgttctcgggatgagcaccagcttgtcttcaggtaagaggacttgacggcaccattta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]