GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-01-31 03:05:04, GGRNA.v2 : RefSeq release 227 (Nov, 2024)

LOCUS       XM_067256890            1814 bp    mRNA    linear   VRT 13-AUG-2024
DEFINITION  PREDICTED: Osmerus mordax claudin-4-like (LOC136962956), mRNA.
ACCESSION   XM_067256890
VERSION     XM_067256890.1
DBLINK      BioProject: PRJNA1145451
KEYWORDS    RefSeq.
SOURCE      Osmerus mordax (rainbow smelt)
  ORGANISM  Osmerus mordax
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Stomiati; Osmeriformes;
            Osmeridae; Osmerus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_090068) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_038355195.1-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/12/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1814
                     /organism="Osmerus mordax"
                     /mol_type="mRNA"
                     /isolate="fOsmMor3"
                     /db_xref="taxon:8014"
                     /chromosome="19"
                     /sex="male"
                     /tissue_type="muscle, testes, liver, kidney, brain, misc"
                     /dev_stage="adult"
                     /geo_loc_name="Canada: Placentia Bay Newfoundland"
                     /lat_lon="47.431645 N 53.826133 W"
                     /collection_date="2019-10-17"
                     /collected_by="Amber Messmer"
     gene            1..1814
                     /gene="LOC136962956"
                     /note="claudin-4-like; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 270 Proteins"
                     /db_xref="GeneID:136962956"
     CDS             56..1120
                     /gene="LOC136962956"
                     /codon_start=1
                     /product="claudin-4-like"
                     /protein_id="XP_067112991.1"
                     /db_xref="GeneID:136962956"
                     /translation="
MANAGFQLLGIALAIIGWIGDIVICALPMWKVTAFVGNNIVTAQIFWEGLWMNCVQQSTGQMQCKVYDSMLALPQDLQAARALVVISILVAFMGIFLAMAGGKCTNCIEDEEAKAKVAIAAGVVFIVAGVLVLIPVSWSANTVIRDFYNPMMLDAQRRELGASLFTLKRMGRQILSFILAFIGFLGTILICALPMWKVTAFIGANIITAQVFWEGLWMNCVLQSTGHMQCKVYDSLLALTQELQAARALICFSIAVGVVAIGLTVVGANCTNFLSYDSPRKSKIGIAAGVVFIAAGVLCEIPVCWSAHSIITGFYNPLVTDGRKGELGASIYVGWVSGALLIIGGGMLCSSFPC"
     misc_feature    68..625
                     /gene="LOC136962956"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:473919"
     misc_feature    563..1099
                     /gene="LOC136962956"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:473919"
ORIGIN      
cacagtcgggtgttgattttattttgggtattcaagttttcagtcatccaccattatggccaacgctgggttccaactcttgggcatcgccctggcaattatcggttggattggagacatcgtcatctgcgcactacccatgtggaaagtgacagccttcgttgggaacaacattgtgaccgcacagatcttctgggagggtctgtggatgaactgcgtgcagcagagtacaggccagatgcagtgtaaggtctacgactccatgctggccttgccccaggacctgcaggcagctagagctttggtcgttatctccattctggtggccttcatggggatcttcctcgccatggctggtgggaagtgcaccaactgcattgaagatgaggaggcaaaagcaaaagttgccattgctgcaggagtcgtcttcatcgtcgcaggggtactggtcttaatccctgtgtcctggtccgccaacaccgtcatcagggacttttacaaccccatgatgcttgacgcccagaggagagagctgggggcatcactgttcactttaaaaagaatgggtagacagattctttccttcatcttggccttcattggtttcctgggcaccatcctcatctgtgccctgcccatgtggaaggtgactgcctttattggagccaacattatcacagcccaggtgttttgggaaggtttatggatgaactgtgtcctgcagagtacaggccacatgcaatgcaaggtctacgactccctgctagccttgacccaggagttacaggctgccagagctctcatctgtttctccattgctgtcggcgtggttgcaatcggtctgactgtagtcggggccaactgcaccaacttcctgagttatgactcgccacggaagtccaagattggcattgcggcaggtgtggtgttcatagcagctggggtcctctgtgaaattcctgtctgctggtcggcccattccataatcactgggttctacaaccccctggtcaccgatgggcgcaaaggggagctgggggcctccatctacgttggatgggtgtctggagctctgctcatcatcggaggggggatgctgtgcagctcatttccctgctaagacgcagggaatcgctgaaggaccatggggattttagatgaacactggattagcagatgcttatggttgtctgctttgcacactcagccctctgtacatgtgtggctccatgagccagagggtggaatccaaactactggacaggccatcaaagtaaacaattagcttgattaaacggcatgtcatgggggctgtgaaagatttacaaagaactgggataagattttaatgaaatgtataatactcgtacatatttgatcaattgactttatctatcgaaaaaatgccagagtaatatgtgtaatctaagcatgctgtatttctttactgtgacttctttgtagcatcctcaggagggagatgggctcagcccaccacataacgtgggcctcctcacaggacaatatttatttttaataaataaacctgcataaactatcatgtgagttagctatttgtattgatacatgagatgattttgatgacaaactgatccagtacatatgtatacacttaatgtaaaaacatagatttttgaagatatgacaatgtatagcagaagttttactgtataataatgtagccaataacttatgatcttgtcataagtaaaatcataagacacaatgcaatagtttgaagtacagtgtttgattaatatgtttctgattaaactgaaacttcctagtcttca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]