2025-10-14 10:49:42, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_067256890 1814 bp mRNA linear VRT 13-AUG-2024 DEFINITION PREDICTED: Osmerus mordax claudin-4-like (LOC136962956), mRNA. ACCESSION XM_067256890 VERSION XM_067256890.1 DBLINK BioProject: PRJNA1145451 KEYWORDS RefSeq. SOURCE Osmerus mordax (rainbow smelt) ORGANISM Osmerus mordax Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Stomiati; Osmeriformes; Osmeridae; Osmerus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_090068) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_038355195.1-RS_2024_08 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 08/12/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1814 /organism="Osmerus mordax" /mol_type="mRNA" /isolate="fOsmMor3" /db_xref="taxon:8014" /chromosome="19" /sex="male" /tissue_type="muscle, testes, liver, kidney, brain, misc" /dev_stage="adult" /geo_loc_name="Canada: Placentia Bay Newfoundland" /lat_lon="47.431645 N 53.826133 W" /collection_date="2019-10-17" /collected_by="Amber Messmer" gene 1..1814 /gene="LOC136962956" /note="claudin-4-like; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 270 Proteins" /db_xref="GeneID:136962956" CDS 56..1120 /gene="LOC136962956" /codon_start=1 /product="claudin-4-like" /protein_id="XP_067112991.1" /db_xref="GeneID:136962956" /translation="
MANAGFQLLGIALAIIGWIGDIVICALPMWKVTAFVGNNIVTAQIFWEGLWMNCVQQSTGQMQCKVYDSMLALPQDLQAARALVVISILVAFMGIFLAMAGGKCTNCIEDEEAKAKVAIAAGVVFIVAGVLVLIPVSWSANTVIRDFYNPMMLDAQRRELGASLFTLKRMGRQILSFILAFIGFLGTILICALPMWKVTAFIGANIITAQVFWEGLWMNCVLQSTGHMQCKVYDSLLALTQELQAARALICFSIAVGVVAIGLTVVGANCTNFLSYDSPRKSKIGIAAGVVFIAAGVLCEIPVCWSAHSIITGFYNPLVTDGRKGELGASIYVGWVSGALLIIGGGMLCSSFPC"
misc_feature 68..625 /gene="LOC136962956" /note="PMP-22/EMP/MP20/Claudin family; Region: PMP22_Claudin; cl21598" /db_xref="CDD:473919" misc_feature 563..1099 /gene="LOC136962956" /note="PMP-22/EMP/MP20/Claudin family; Region: PMP22_Claudin; cl21598" /db_xref="CDD:473919" ORIGIN
cacagtcgggtgttgattttattttgggtattcaagttttcagtcatccaccattatggccaacgctgggttccaactcttgggcatcgccctggcaattatcggttggattggagacatcgtcatctgcgcactacccatgtggaaagtgacagccttcgttgggaacaacattgtgaccgcacagatcttctgggagggtctgtggatgaactgcgtgcagcagagtacaggccagatgcagtgtaaggtctacgactccatgctggccttgccccaggacctgcaggcagctagagctttggtcgttatctccattctggtggccttcatggggatcttcctcgccatggctggtgggaagtgcaccaactgcattgaagatgaggaggcaaaagcaaaagttgccattgctgcaggagtcgtcttcatcgtcgcaggggtactggtcttaatccctgtgtcctggtccgccaacaccgtcatcagggacttttacaaccccatgatgcttgacgcccagaggagagagctgggggcatcactgttcactttaaaaagaatgggtagacagattctttccttcatcttggccttcattggtttcctgggcaccatcctcatctgtgccctgcccatgtggaaggtgactgcctttattggagccaacattatcacagcccaggtgttttgggaaggtttatggatgaactgtgtcctgcagagtacaggccacatgcaatgcaaggtctacgactccctgctagccttgacccaggagttacaggctgccagagctctcatctgtttctccattgctgtcggcgtggttgcaatcggtctgactgtagtcggggccaactgcaccaacttcctgagttatgactcgccacggaagtccaagattggcattgcggcaggtgtggtgttcatagcagctggggtcctctgtgaaattcctgtctgctggtcggcccattccataatcactgggttctacaaccccctggtcaccgatgggcgcaaaggggagctgggggcctccatctacgttggatgggtgtctggagctctgctcatcatcggaggggggatgctgtgcagctcatttccctgctaagacgcagggaatcgctgaaggaccatggggattttagatgaacactggattagcagatgcttatggttgtctgctttgcacactcagccctctgtacatgtgtggctccatgagccagagggtggaatccaaactactggacaggccatcaaagtaaacaattagcttgattaaacggcatgtcatgggggctgtgaaagatttacaaagaactgggataagattttaatgaaatgtataatactcgtacatatttgatcaattgactttatctatcgaaaaaatgccagagtaatatgtgtaatctaagcatgctgtatttctttactgtgacttctttgtagcatcctcaggagggagatgggctcagcccaccacataacgtgggcctcctcacaggacaatatttatttttaataaataaacctgcataaactatcatgtgagttagctatttgtattgatacatgagatgattttgatgacaaactgatccagtacatatgtatacacttaatgtaaaaacatagatttttgaagatatgacaatgtatagcagaagttttactgtataataatgtagccaataacttatgatcttgtcataagtaaaatcataagacacaatgcaatagtttgaagtacagtgtttgattaatatgtttctgattaaactgaaacttcctagtcttca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]