2025-02-01 14:59:51, GGRNA.v2 : RefSeq release 227 (Nov, 2024)
LOCUS XM_067191187 4266 bp mRNA linear INV 09-AUG-2024 DEFINITION PREDICTED: Acropora muricata protein argonaute-2-like (LOC136922843), transcript variant X4, mRNA. ACCESSION XM_067191187 VERSION XM_067191187.1 DBLINK BioProject: PRJNA1140574 KEYWORDS RefSeq. SOURCE Acropora muricata ORGANISM Acropora muricata Eukaryota; Metazoa; Cnidaria; Anthozoa; Hexacorallia; Scleractinia; Astrocoeniina; Acroporidae; Acropora. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_090042) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_036669905.1-RS_2024_08 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 08/07/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..4266 /organism="Acropora muricata" /mol_type="mRNA" /isolate="sample 2" /isolation_source="Coral reefs" /db_xref="taxon:159855" /chromosome="7" /tissue_type="Polyps" /geo_loc_name="China: Spratly Islands" /collection_date="2017-10-20" gene 1..4266 /gene="LOC136922843" /note="protein argonaute-2-like; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 130 long SRA reads, 4 Proteins" /db_xref="GeneID:136922843" CDS 221..2548 /gene="LOC136922843" /codon_start=1 /product="protein argonaute-2-like isoform X2" /protein_id="XP_067047288.1" /db_xref="GeneID:136922843" /translation="
MKRSGGIIGYRTMHQRLVNHHNLVDFHVTLPMENSKDKTFKVTVKWVAQVSLFALEQALEGKHNQIPFEAIQALDVVLRHLPSMKYTSVGRSFFSPPEGYYHPLESGREVWFGFHQSVRPSQWKMMLNIDVSATAFYKCQPVVEFLCEVLRKSPQDLQRGKPLTDAERMKLSREIKGLKVEITHCGTMKRKYRVINVTKQPAQSLKFPLKQMDTGQQREITVARYFQEKHSKKLQYPHLPCLQVGQEQKHTYLPMEVCNLVAGQRCIKRLTDQQTAKMIRATAKRAPDRENEILNLVRKADFKNDPYAIDFGISISDNMVELSGRVLDAPKLQYGGRDKPKIYPSFGVWDMRGKHLYHGIEIHTWAIACFVNPQDCSDRTLKNFTGQLMKISGETGMPIRSEPCFCRYAKKAEDVEPMFKYLMSTFSNLQLIILVLPGKTPVYAEVKRVGDTALGIATQCVQAKNIAAYKPQTLSNLCLKINAKLGGINSILAPDVRPPVFREPVIFLGADVTHPAAGDGRQPSIAAVVGSMDAHPSRYCASVRVQTHRQEIIAELAAMVRELLIQFYRSTRHKPMRIIFYRDGVSEGQFRQVLCHELKAIREACIKLEVGYQPGITFIVVQKRHHTRFFCQDEKDRCGPSGNVPPGTTVDSGITHPSEFDFYLCSHAGIQGTSRPSHYHVLWDDNNFEADEIQALTYQLCHTYVRCTRAVSIPAPAYYAHLVAFRARFHLTERERESPESGSSGSAGHGESRNSQILAKAVQVHPEMLKCMYFA"
misc_feature <311..454 /gene="LOC136922843" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:465134" misc_feature 482..634 /gene="LOC136922843" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:462567" misc_feature 638..1003 /gene="LOC136922843" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(794..796,839..841,884..886,896..898,950..952, 971..973,977..979) /gene="LOC136922843" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1136..2413 /gene="LOC136922843" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1547..1549,1559..1561,1595..1606,1613..1615, 1637..1639,1646..1648,1658..1660,1670..1672) /gene="LOC136922843" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1751..1753,1757..1759,1967..1969,2381..2383) /gene="LOC136922843" /note="active site" /db_xref="CDD:240015" polyA_site 4266 /gene="LOC136922843" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
gcaaccagcagtacaacaaaataacttacaacgcgacaatttgattgagctataatctcatttggggctgcagcgctgggagatactggcctttcttctgcgccagcatggaatcaggttaggcgtacgtcagctgaaaaaattttggtctcgtagaggattaacacgaagaaacaacggcagtgatgtgtaggatattttacacgctgtagaaacagaaatgaaacgcagtggaggcattattggttaccgtacaatgcatcaaagactcgtcaatcatcataacctggtggattttcatgtcactcttccaatggagaacagcaaagataaaacattcaaagtgacggtaaaatgggtcgcgcaagtcagcctctttgcactggagcaggcgttggagggcaaacataatcagattccatttgaagcaatccaagcccttgatgttgtgttgaggcatttaccttccatgaaatacacctcagtaggaagatctttcttttccccccctgaaggctactatcatcccctggagagcggccgggaagtatggtttggttttcatcagagtgtgagaccctcgcagtggaaaatgatgctgaacatcgatgtgtccgcaacagcattttacaaatgtcagcccgtcgtggaattcttatgcgaagtccttcggaaatcgccgcaagatcttcaacggggcaaacccttaacagatgctgagagaatgaagctaagtagagaaatcaaaggactcaaagtggaaataactcactgtggcacaatgaagagaaagtacagagttattaacgttacaaaacaaccggcgcaatctttgaaatttcctcttaagcaaatggacacgggacagcaacgagagatcacggtggcgagatacttccaggaaaaacactcaaagaaacttcagtacccgcatcttccgtgccttcaagttggacaagaacaaaaacacacttaccttccaatggaagtttgtaaccttgtcgctggtcagaggtgtataaagagactaacagaccagcaaacagccaagatgattcgagccacggcgaagagagctccggacagagaaaacgagattctgaacttggtccgaaaagctgatttcaaaaacgatccgtacgctatcgactttggcatttccattagtgataacatggtggagctgtcaggacgagttctcgatgctcccaaactgcaatacggaggacgggacaaaccgaagatctatcctagctttggggtgtgggatatgcgtggaaaacacctttaccatggcattgaaatacacacgtgggcaattgcttgttttgtgaatccacaagattgtagtgacagaactctaaagaatttcactggtcaacttatgaagataagcggtgaaactggaatgcccatccgatctgaaccttgtttctgtagatatgccaagaaagcagaagatgttgaaccaatgttcaagtatttgatgtctacgttcagcaatctgcaactaattatccttgtattacccggcaaaactccagtttatgcggaagtgaagagagtaggagacacagcgcttggcatcgcgacccaatgtgtacaagccaaaaacatcgccgcatataaaccccaaactctgtcgaatttgtgcctgaaaatcaacgccaaattgggtggaatcaacagcattttagctccggacgttcgaccacccgtgtttcgtgagccagtcatctttttgggggctgatgttactcatccagctgcgggagacggaaggcaaccatccattgctgccgtcgtaggtagcatggacgcccatccaagccgctattgtgcttcagtacgggtccagacacatcgacaggaaatcattgctgagttggcagccatggttcgtgaattactgattcaattctatcgttccacaaggcacaaacccatgagaattattttctaccgcgatggagtaagtgaaggccagtttaggcaggtgctttgtcacgaacttaaagcgatccgcgaagcttgtataaaactagaggttggctatcaacctggtatcacatttattgtggttcaaaagagacatcacacaagattcttctgccaggacgaaaaagatcggtgtggtccaagcggaaatgttcctccaggaacaactgttgacagtgggattacacatccttctgagttcgatttttatctttgtagtcacgccggaattcaggggacaagccgaccttcgcattatcatgttctttgggatgataataacttcgaagccgatgagattcaggccctgacctaccagctgtgccacacttacgttcggtgcacccgtgcggtgtctattccagcccccgcttattacgcacatttggtggcattcagagcacggttccatttgaccgaaagagagcgagaaagtcccgagagtggatcatccggtagcgccggccatggggaaagcaggaattcgcaaatcttagccaaagcggtccaagttcacccggagatgctaaaatgcatgtacttcgcttgaagacgcattgtgtagtaccacaagaacaaagcactgtagggtatttttctttatttagtttcttattttaaattctttgtatatatcgagcaaacaggacgagtttcttttcaagtggaggcgcattgcgtaagaaacaaaaaatggtgatatcttttcagacttgtctagatgaatttcctttgtagataatgtacatctttttgtcaaccaataaacgaaataaagaaaatcgatttttataggacttttttggggggttaacccttagcccttataaaaataatgtcattttatatagcaaactggacgagtttcttttcaagtggaggcgcattgcgtaagaaccaaaaaaatggcgatatcttttcagacttgtctagatgaatttccttcgtagataatgtacatcctcttgtcaaccaataaacgaaataaagaaaatcgacttttttgggggggttaacccttagcccttataaaaataatgtaattttatattacattatttttattatcttgtacttattatcttttttattatattgttatatcctacgttgtatgtgaattatttattattctgtaattattcctcatagtatagtcataacggtttttggagtactatgatcgaagattaaagatgaaagccctgccgggcggtggacgccatctaccgtgcagcccttccgataagactgaccccagggcatcgactggctgttgcaaacaggggataaaggatgccctttgctcacagcagggctgtaagcgaagcaggttgccttggtataaaaaaatgtgggattgctattgtctctggtactcaggctccttcgactgctgctcctgagctgtcaccccctgttttagcagtaaatacgtaagctggctgtgtgagaacgttaaaatgaccttttctcacgtattgtaccttttttgtaacttttgagtatggataaaaatcttaaagtgtgaccattcaaatgaaagctattgagaagcacgttcctgaatcctaaattgttagtgaccattcaaactaaagctacagtgaacagctaacagtttccatgtgctcccctcgagtgacatcaagttgaatgttgatgtattcttccaagcaactgtgtgcttggctgagagcagtggaatttcagcttcatgttcaaatactcatctggggatgtttgaaatttcctagttaattacgtatagagaccgtactgaagacctctggcacattttctccccatacggaccgacctaggccagcaaataacgtgtttattttttcttccgtagattactttgtaagcagttttgtgttgaattttcaatgcagcgattttcaaacctggtgtacgggtgcgtttgacatttaagaaataggaaataataggaataagaatccataattgtttgtttctcaggtcattatttacattttacgttctttgcagtgaaaaaaaaaactgctagaaaagacgcgaaagctggaaaattaggagcggtccgtacgcttaagcgcgcgcaattagccaatcagattcaaggaattaggattacggaccgctcagatgcttgagaaaataataaaataacgttatttacatgttatctgatgactagtagtatttcaaagttatcgtaaatttcactgacctatgggcttgtgaatagttatatgaattacaattttgagacatctctta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]