GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-20 18:43:27, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_035519055            2880 bp    mRNA    linear   PLN 04-AUG-2020
DEFINITION  Lasiodiplodia theobromae Rna interference and silencing protein
            (LTHEOB_9465), partial mRNA.
ACCESSION   XM_035519055
VERSION     XM_035519055.1
DBLINK      BioProject: PRJNA645153
            BioSample: SAMN07172427
KEYWORDS    RefSeq.
SOURCE      Lasiodiplodia theobromae
  ORGANISM  Lasiodiplodia theobromae
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Dothideomycetes; Dothideomycetes incertae sedis; Botryosphaeriales;
            Botryosphaeriaceae; Lasiodiplodia.
REFERENCE   1  (bases 1 to 2880)
  AUTHORS   Ali,S.S., Asman,A., Shao,J., Balidion,J.F., Strem,M.D., Puig,A.S.,
            Meinhardt,L.W. and Bailey,B.A.
  TITLE     Genome and transcriptome analysis of the latent pathogen
            Lasiodiplodia theobromae, an emerging threat to the cacao industry
  JOURNAL   Genome 63 (1), 37-52 (2020)
   PUBMED   31580730
REFERENCE   2  (bases 1 to 2880)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-AUG-2020) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 2880)
  AUTHORS   Bailey,B., Ali,S., Shao,J. and Meinhardt,L.
  TITLE     Direct Submission
  JOURNAL   Submitted (10-JAN-2020) Agricultural Research Services (ARS),
            United State Department of Agriculture (USDA), 10300 Baltimore Ave,
            Beltsville, MD 20705, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_023336511).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..2880
                     /organism="Lasiodiplodia theobromae"
                     /mol_type="mRNA"
                     /strain="AM2As"
                     /isolation_source="young plant"
                     /host="Theobroma cacao"
                     /db_xref="taxon:45133"
                     /chromosome="Unknown"
                     /country="Indonesia"
                     /collection_date="Mar-2014"
     gene            <1..>2880
                     /locus_tag="LTHEOB_9465"
                     /db_xref="GeneID:56023761"
     CDS             1..2880
                     /locus_tag="LTHEOB_9465"
                     /codon_start=1
                     /product="Rna interference and silencing protein"
                     /protein_id="XP_035368692.1"
                     /db_xref="GeneID:56023761"
                     /translation="
MSHKKTTKSTQPDSGGDATNHLSLPYETGAFAGNSDGARSPNLSEDSYPSGSQRSSSYSPPQRSSSAAKTIRTHSRTASGVRVDDLSVVVTEQMGMVTIHERPATTINSTVGKHFEVDEPSGRICKHSVSYFSTSSQKQVKNRALKRQLLQKVLERHLTDSGGTKPIVEGIDAIYSKNPLHSGLQAAPSEMFFDITHQPKSSEEGTNFRIRVLRQPDVKFDNLAKSLQNCECSGTSACSAQDCFHTLNILLRSVLSQSEGWFCVNKNLWLSKEAMSIDAEVETSQYVKLHDGMTFSIDLTEKKCGSPSDRKLMLTVSPRPTLFVEACNLGVFYADYIDNFQEDAANKAKALRSFIKRLEVTQAYKPSRDDGAPRIIRAPQSPRDLPSNARRRQIVSLGQSATEQKFKLDEAGMATEEISVSCYFEQYYGYKLRFPNLPVVNVWDSAKKIWIPMELLWVKEQPVFKFPPLQMKDGFKPIHMKCEESVRNFDANLSDKHSKVVKLLNPTLLKDAFGITFKSEAENITAYFVDSPPEGPQEKHRHVKDKRIKAPKFADSPQMVRFLTLKSGLERHTRKEQEVFEGACKKLLVAFQTEGGLCDEPKAAYDYDTFQSFLGAVDNAESPLKRFSPKSDMLLLVGLDAAKEGQADTQARIRCWCDKNNVPTVFFDVQKFQENMKHWERSEKGTNVPEIRQAVGYARALVTKAVHRCAGRVPSTQEINPADREDLKKLLKETMVVGASLTSGQSDPSDDLPSIAAVTTSLGDDFVQYQGRFRLQKSGQKTIVNLSDMLKEMLSEYAQAHGNRLPESILYLREGISKDHFHLIRNDEIRKIADAFNELCTQKPQLVVSNAAPNITFIALSKRAKPRFFPDGDRIARLTAKNLKEGIVVDAMDIQVPTAKGREFDFHLQSHSNSCDSAKQCGFISNTHYYVLKHENGWSQEEVERIVSLTLPDSGLLWD"
     misc_feature    1036..1368
                     /locus_tag="LTHEOB_9465"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1126..1128,1216..1218,1258..1260,1270..1272,
                     1324..1326,1345..1347,1351..1353)
                     /locus_tag="LTHEOB_9465"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    <2194..2841
                     /locus_tag="LTHEOB_9465"
                     /note="PIWI domain. Domain found in proteins involved in
                     RNA silencing. RNA silencing refers to a group of related
                     gene-silencing mechanisms mediated by short RNA molecules,
                     including siRNAs, miRNAs, and heterochromatin-related
                     guide RNAs. The central component...; Region: Piwi-like;
                     cl00628"
                     /db_xref="CDD:412485"
ORIGIN      
atgagccacaagaagaccaccaaatccactcagcctgattctggaggtgatgctacgaatcacctttctttaccgtacgaaacgggggcttttgccggcaactctgacggagctcgctccccaaacctcagcgaagattcgtatccaagcggatctcaacgctccagctcttactctcctccccaaaggtcatcatccgctgcaaagacaattcgtacccattcccgaacggccagcggtgtgcgtgtcgacgacttgtctgttgttgtcaccgaacaaatgggcatggtcactattcacgaacgccccgctacaaccatcaactcaacggtcggcaaacacttcgaagtagatgaaccctctgggcggatttgcaagcattcagtttcctacttttcaacaagttcccaaaagcaagtcaaaaacagagctctcaagcgccaattgttgcagaaagttcttgagcgtcatctcaccgattctggtggcaccaaaccaatcgttgaaggaattgatgcaatctactccaagaatcctctgcattcaggtttgcaagcggcgccgtctgagatgttttttgacatcacgcaccaaccgaagtcgtcagaggaaggaaccaactttcgaattcgagtacttcgccaaccggacgtcaagttcgataatctcgcaaagagcttacagaattgcgagtgcagcggtaccagcgcatgctctgcccaagactgtttccacaccctgaacatcttgttacgatcggttttgagccagagtgagggatggttctgcgtcaacaagaacctatggctttccaaggaggcgatgagcattgacgccgaagtcgagacgagccaatacgtcaaactgcatgacggcatgactttttccatcgatcttacggagaagaagtgcggttctccttccgatcgcaagctgatgctgaccgtcagccctcgtccaacgctgtttgtggaagcctgcaaccttggggttttctacgccgattacatcgacaacttccaagaagacgccgctaacaaggccaaagcccttcgctcattcatcaaaaggctagaagttacccaggcatacaagccgtctcgggacgatggagcacccaggattatcagagctccgcagagcccgagggacctcccgtcaaacgcccgtcgacgccaaatagtttcccttggtcagagtgccacggaacagaaattcaagcttgacgaagctggaatggccactgaagaaatctccgtgagctgctacttcgagcagtactacggctacaagctcagatttccaaatctccccgtggtgaacgtttgggacagtgcaaagaagatttggatcccaatggagctgctttgggttaaagagcagccagtcttcaagttcccgcccctccagatgaaagacggattcaagcccattcacatgaaatgtgaagagtcggttcgcaattttgatgccaacctcagcgacaagcacagtaaggttgtgaaacttctcaatcccacattgctgaaggatgcctttgggattacattcaaatcagaagcagagaatatcacagcctactttgtggactctccacctgaaggaccccaggagaagcataggcacgtcaaggacaagcgaatcaaggctccaaagtttgcagattctcctcaaatggtccgcttcttgactctgaagtctggattggagcggcatactaggaaagagcaagaggtttttgagggagcctgcaaaaagctgctcgtagcttttcaaacggaggggggcctctgcgacgagccaaaagcagcatatgactacgacactttccaatcgttccttggagcagtcgacaatgcagaatcacccctcaagcgattctctccaaagagtgacatgttgctcctcgtcggtcttgatgcggccaaggaggggcaggcagatacccaagccaggattagatgttggtgtgacaagaacaacgttccaacggttttctttgacgttcagaaattccaggaaaacatgaagcattgggaaaggagtgagaaggggactaacgtgccggagatcagacaagcggtggggtatgccagagctcttgtcacgaaggctgtccacaggtgcgccggtcgggttccgagtactcaggaaatcaacccagccgaccgtgaagacctcaagaagcttctgaaagagacaatggtggttggagcgtctttgacttctggccagagtgatccatcggacgatctgccttcaatcgcagcagtcacgacaagcctgggagacgacttcgtccagtatcagggccgcttccgcctacaaaagtctgggcagaagacaattgtgaatctcagcgacatgttgaaggagatgctatccgaatacgcacaagcccatggtaatcggctgccagagtcgatcctctatttgcgggaaggtatttcaaaggaccactttcacctcatcagaaatgatgaaatccgcaagatagcggatgccttcaacgagctttgcacacaaaagccgcagctggtcgtgtcaaacgcggcgccaaacatcaccttcatcgctctctcaaagcgtgcaaagcccagattcttccccgacggtgataggatcgcacgattgacggccaaaaatctgaaagaggggatagtcgtcgacgccatggacattcaggtaccgactgcgaaggggcgggagttcgacttccatctccagtcacactcgaattcctgcgacagtgccaagcagtgtggcttcatctccaacactcattactatgtgctgaagcacgaaaatggatggtcccaggaggaggttgagcgcattgtgagtctaactttgcccgattctggattgctgtgggactaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]