2024-05-02 07:11:55, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_031903275 2804 bp mRNA linear VRT 18-DEC-2019 DEFINITION PREDICTED: Xenopus tropicalis testis and ovary specific PAZ domain containing 1 (topaz1), transcript variant X2, mRNA. ACCESSION XM_031903275 VERSION XM_031903275.1 DBLINK BioProject: PRJNA205740 KEYWORDS RefSeq. SOURCE Xenopus tropicalis (tropical clawed frog) ORGANISM Xenopus tropicalis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae; Xenopus; Silurana. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_030682.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Xenopus tropicalis Annotation Release 104 Annotation Version :: 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2804 /organism="Xenopus tropicalis" /mol_type="mRNA" /strain="Nigerian" /db_xref="taxon:8364" /chromosome="6" /sex="female" /tissue_type="liver and blood" /dev_stage="adult" /note="F17 inbred" gene 1..2804 /gene="topaz1" /gene_synonym="c3orf77" /note="testis and ovary specific PAZ domain containing 1; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 13 samples with support for all annotated introns" /db_xref="GeneID:100380130" /db_xref="Xenbase:XB-GENE-5887135" CDS 152..2641 /gene="topaz1" /gene_synonym="c3orf77" /codon_start=1 /product="protein TOPAZ1 isoform X1" /protein_id="XP_031759135.1" /db_xref="GeneID:100380130" /db_xref="Xenbase:XB-GENE-5887135" /translation="
MFYTQLLFHCYRSSTHDVVPDDPELFGTPEDPYISPICNADNKENNKRNNLSALMCNLQEQESAHINESTNDASPEENVEERSTYFAKVITDLEVNDDPLIIHNTLEKNSEDFYDGGQFDFEAFRDLDTDKEIKYAEKNSSESGSSFEESLSKDTSPGSSHSNSRRWRRDPSHTYKPMHWMNDFRYSGKCMGLTDVITLDQKEQRNIDNLFYDFTPIQKTFLPIRYCKYFFNTFRGCIKPDCMYQHVPFQRDEKVCMEVIHKLVNENHTTLLKRAVWIFTAYYRMYMPGVHYDSNLLTKMLRALYVRQMWGDVFQLLETGANVKILPSSEMLIRLFENIGSTGLTAAVPSLVDVFCKLVEAGMMMKPEQINMLITTLNNLQATKNYISVILDIKTRIEMQLSEKNWLCNLDIAVAEVGHCKEKNDWKKLGTLYLNLRTGCENVTDLKKFSNCIVGALQKVPRNDKSEIPYCDFADTVYKDAQLSEIDKNILGRIGISIMYHYYRNKQSQKGKRVLRKLQEMQINFTVLKGLTGEESKATRCQVVNTAVEIFLNCEYLNGALGVLRESEWIINTQVWPCERMDVLKRHNLLCTIAQKTLNKNMFDVCLEVLQNLPGLQCSLTDVDVSQYSLLFNKLLSSCIENNTLGVSSTVIDFMIAKKIPLDFFLLRALITSLGRSCLWLRARELYKCAVLLGCYPPMEGNLYRKVLFIPSFLSEIEMLLSIEIFMVSNASSIQSPGGSHQTLQIILKRCEEERVPNKDYQRGKASYQDAVDRLIQASRLSTPRLFIKHLTVNNANEQVYILDYGSSLKWLHENMKWAGKVWLFQGKI"
misc_feature 1400..1927 /gene="topaz1" /gene_synonym="c3orf77" /note="Putative aspartate racemase; Region: Asp_Glu_race_2; pfam14669" /db_xref="CDD:434113" ORIGIN
cgtcattaacgtgagagaagcgtagtatgccgcgcaggcggagctgaatttgcgacttccggaagcgcgccgaatgacagcagaaatgctgtggattcccttgtgtttcagagcataagaggaaaaaggagagtgcacagcagaaaactttatgttctacacacaactgttatttcactgttacagatccagcacacacgatgttgttccagatgatccagagctttttgggactcctgaagatccttacataagtccaatttgtaatgctgacaacaaagaaaataataaacggaataatctgagtgcattaatgtgtaaccttcaggaacaggagagcgcccatatcaatgaaagcacaaatgatgccagccctgaggaaaatgtagaagagagaagtacatattttgcaaaagtaatcactgatctagaagttaatgatgatcctctcatcatacataacactttggaaaagaacagtgaagatttttatgatggtggacagtttgattttgaggcgttcagagatcttgacacagataaagagattaaatatgctgaaaagaattcatctgaaagcggaagcagttttgaagagtccttgtccaaggatacttctccggggtcctctcattccaatagccgtcgttggagaagagatccctcacatacctataagcctatgcattggatgaatgatttcagatactctggaaaatgcatgggattgacggatgtgattactttggatcagaaagaacagaggaatattgataatctcttttacgattttacacctatacagaagacctttttgcccattagatactgcaaatatttttttaatactttccgtggatgcattaaaccagattgtatgtaccagcacgtaccattccaaagggatgaaaaggtgtgcatggaggtgattcacaaacttgtgaatgaaaatcacacaacattattaaaacgtgctgtttggatatttactgcctactacagaatgtatatgcctggtgttcattatgactcaaatctgctgaccaaaatgctccgtgccttgtatgttcgtcagatgtggggagatgtatttcagttgttggaaactggtgccaatgtcaaaatattgccctcctctgaaatgcttatcaggttatttgaaaatattggctctacgggattaacagcagctgtacctagtttagtggatgtattctgcaagcttgtggaggctggaatgatgatgaagccagagcaaatcaacatgttaataacaacactgaataatctccaggcaacaaaaaattatatcagtgtcattttagacataaaaacaagaattgaaatgcagctttcagaaaagaactggctgtgtaacttggatatagcagttgcagaagttgggcattgtaaagaaaaaaatgattggaagaaactaggaacattatatcttaatctgcgtacagggtgtgagaatgtgactgatcttaagaagttttctaattgcattgtcggggcgcttcagaaagtgccaaggaatgataaatctgaaattccatattgtgactttgcagacacagtgtacaaagacgcccaactaagtgaaattgacaaaaacattttgggaaggattggaatatccatcatgtatcactattacagaaataaacaatcgcaaaagggaaagagggtgctcagaaaacttcaggaaatgcagattaatttcacagtcctaaaaggactcacaggggaagagagtaaagctacgcgctgtcaagttgtgaacacagctgtagagatcttcttgaactgtgaatacttaaatggtgcactgggggttctacgagagtcagagtggatcattaacacacaagtgtggccctgtgaaagaatggatgtgctgaaacgacataacctgttgtgtacaattgcacagaaaacactgaataaaaacatgtttgatgtgtgtcttgaggtccttcagaatctgccaggactgcagtgctcattaacggatgtggatgtctctcagtacagcttgcttttcaacaaacttttgtcatcctgcatagaaaataatacacttggtgtatcctcaactgtgatagattttatgattgcaaaaaaaataccacttgactttttcttactgagagcactaatcacatccttgggacgaagctgtctatggctcagagcaagagaactttataaatgcgctgttttgttgggttgctacccgcccatggaaggaaatctgtatcgtaaagtgctcttcatcccctcattcctttctgagatagaaatgctgttatccattgaaattttcatggtgtcaaatgccagtagtattcagtcaccaggaggcagccatcagactctgcaaatcattctcaaaagatgtgaagaagagagagttccgaataaagattatcaaagaggtaaagctagctatcaagatgcagtggaccggctgattcaggcctctaggctatcaacaccaagattattcataaagcacctgactgtcaataatgccaatgaacaggtttatatccttgattacggcagctctctcaaatggttgcatgaaaacatgaaatgggctgggaaagtatggctttttcaggggaaaatataacttgatatcaggaggtttaactaagcaagtaatgaaaattttaaattaaagtgtctgtttaatttgttttattaatgtgtattttccacttttattgtccttatctgttgacaaaatggtttaagactgtacacaaaataaaatatatagtataaggaaaaca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]