GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-02-23 19:55:58, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_030883597            3350 bp    mRNA    linear   MAM 26-NOV-2024
DEFINITION  PREDICTED: Globicephala melas NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), transcript variant X2,
            mRNA.
ACCESSION   XM_030883597
VERSION     XM_030883597.2
DBLINK      BioProject: PRJNA1026603
KEYWORDS    RefSeq.
SOURCE      Globicephala melas (long-finned pilot whale)
  ORGANISM  Globicephala melas
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Whippomorpha;
            Cetacea; Odontoceti; Delphinidae; Globicephala.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_083315) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Oct 24, 2023 this sequence version replaced XM_030883597.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_963455315.2-RS_2024_11
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 11/21/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3350
                     /organism="Globicephala melas"
                     /mol_type="mRNA"
                     /db_xref="taxon:9731"
                     /chromosome="2"
     gene            1..3350
                     /gene="NRDE2"
                     /note="NRDE-2, necessary for RNA interference, domain
                     containing; Derived by automated computational analysis
                     using gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins"
                     /db_xref="GeneID:115867337"
     CDS             54..3221
                     /gene="NRDE2"
                     /codon_start=1
                     /product="nuclear exosome regulator NRDE2 isoform X2"
                     /protein_id="XP_030739457.1"
                     /db_xref="GeneID:115867337"
                     /translation="
MALFPAFAGVSEEPESGSPRKELDWLSNPSFCVGTITSLSQQTEEVTTFVSEESLLTRSPLNSEPSGESDTNKKPKQTSRKKKKEKKKKRKHQHHKKTKRKRGQSSSSGSESYTDSEKDISSRSIRSSKKESEKPNQENNATADIGRHFVWLEDIQALTGETFRTDKKPDPANWEYKSLYRGDVARYKRKGDSCLGINPRKQCISWEGTSTEKKRSHKHVERYFTKKSVGLMNIDGVAISSKTEPPSSESISFIPVKGAEDVVSPVTTWLNPLGIYDEATTQWLQGRGPSEQESKQPDSQPNRENVLLKAKVEEFNRRLWENPRDIQLWMAFVAFQDEVMRSPGLYAIEEGQQEKRKRSLKLVLEKKLAILERAVESNPSSVDLKLAKLQLCTEFWEPSTLVKEWQKLIFLHPNNTALWQKYLLFCQSQFSTFSISKIQSLYGKCLSTLSAVKDGSILSHPELPGTEEAMFALFLQQCHFLRQAGHSEKAVSLFQAMVDFTFFKPDSVKDLPTKGQVEFFEPFWDSGEPRAGEKGARGWRAWMQQQERGGWVVVSPDDDDDEPEDDDQEIKDKTLPRWQIWLAAERSRDHRHWRPWRPEKTKKQAEEDCEDPERQVLFDDIGQSLIQLSSPDLQFRLIAAFLQFLGVPSGFSPPASCLYLAMDENSIFDNGLYDEKPLTFLNLSFSGVSCIGRTDQLGCRHWTRGHSREGEEFIRNIFHLVMPLFSGKERSQLCFSWLQYEIAKVVWCLRTKNKKRLKSQGKNCKKLAKNLLKEPDNRNNFCLWKQYAHLEWLLGNTEDARRVFDTALGMAGSRELKDHELCELGLLYAELEVELLPDVRGAAPARAIHVLTRLTENGAYGPYTGQVLAVHILKARKAYEHALQDCLGESCVSDPAPADSFSRLISLVKCFMLFQYLTIGIDAAVRIYEQVFAKHKVSVSAEGPGLEGSASPPSLSSVLEAVTLMHTSLLRFHMKVAVYPLAPLREALSEALKLYPDNQVLWRSYVQIQNKSHSASKTRRFFDAITRSAKPLEPWLFAIEAEKMRKRLVETVQRW"
     misc_feature    537..824
                     /gene="NRDE2"
                     /note="MTR4-interacting domain (MID) found in nuclear
                     exosome regulator NRDE2 and similar proteins; Region:
                     NRDE2_MID; cd22200"
                     /db_xref="CDD:412062"
     misc_feature    order(537..563,570..575,585..590,594..596,600..644,
                     651..659,663..671,693..701,711..716,720..725,732..752,
                     777..788,798..824)
                     /gene="NRDE2"
                     /note="MTR4 binding site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:412062"
     misc_feature    993..1991
                     /gene="NRDE2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:462472"
ORIGIN      
tcggcttcccgccgccatttttgtggagtgaaaaggcggtgtggcctgtgaacatggcgctgttccccgcctttgcgggtgttagtgaggagcccgagagcgggagccccaggaaagaattagactggctgagcaacccaagcttttgtgttggaaccataacatctctgagccaacaaactgaagaggtcacaacctttgtttctgaagagtcgctactgaccaggagtcctctgaattcagagccttcaggtgaaagtgacactaacaaaaagcccaaacaaacaagcagaaaaaagaagaaagagaaaaagaagaaaaggaagcatcagcaccacaagaaaaccaagagaaaacgtggacagtcaagtagcagtggatctgagtcatatactgattctgaaaaagacatatcgtccagaagcatcagaagcagtaaaaaggaatcagagaaaccgaatcaagaaaataatgccactgctgatattggacgtcactttgtttggcttgaggacattcaggctctgacgggagaaaccttcagaacagataagaagccggatcctgcaaactgggagtataagtctctttaccgaggagatgtagcaagatacaagaggaaaggagactcctgccttggcattaaccctaggaagcagtgtatatcttgggaggggacttccacagaaaagaagcggtcacacaagcatgtcgagcgctactttacaaagaagagtgtgggattaatgaacattgacggagttgccattagcagtaaaactgaacctccctcatcagagtcgatctcatttatcccagtgaagggtgcagaggatgtggtttcccctgttacaacctggttgaaccctctggggatttatgatgaagccaccacgcagtggttgcaaggccggggtccttcagagcaagaatccaagcagccagattcacagcccaacagagagaacgtgcttctcaaggccaaggtggaggagtttaacaggaggctttgggagaatcctcgggacattcagctgtggatggcatttgttgcttttcaggacgaggtcatgaggagtccgggcctgtatgccatcgaggaaggacagcaggaaaagcggaagcggtccctgaagctggttctggagaagaagctggccattctggaacgggccgtggaaagcaacccgagcagcgtggatctgaaacttgccaagctgcagctctgcaccgagttctgggagccctccactctggtcaaagagtggcagaaactgatatttttacatcccaacaatacagccctttggcagaaataccttttattttgccagagccagtttagcaccttttccatatcaaaaattcagagtctttatggaaaatgcttgagtactttgtctgctgttaaggacggcagcatcttgtctcaccctgagctgcctggcactgaggaggccatgtttgccctctttcttcagcagtgccactttctgcggcaggctggtcactccgagaaggccgtctctctgttccaggccatggttgacttcaccttcttcaaacccgacagtgtgaaagacctgcctaccaaaggacaggtagaattctttgagcccttttgggacagtggagagcccagggccggggagaagggcgcccgaggctggagagcgtggatgcagcagcaggagcggggcggctgggtggtcgtcagcccagatgatgacgatgatgaaccagaagacgacgaccaggaaattaaagataagactctgcccaggtggcagatctggcttgctgctgagcggtcccgagaccacagacactggcggccgtggcgccctgagaagaccaagaagcaggcggaggaagactgtgaggacccggagaggcaggtgttgtttgatgatattggacagtctctgatccagctttccagcccggatcttcagtttcggctgattgcagcctttctgcagttcttgggtgtgccttccggcttcagccctccggcctcctgcctctatctggccatggatgagaacagcatctttgacaatggactttatgatgaaaagcccttgacttttctcaacctttcattttctggcgtcagctgtatcggacgcacagaccagctgggttgccggcactggaccaggggtcacagtcgagagggcgaggagttcatccgcaacatcttccacctcgtgatgcctttgttttcaggcaaggagaggtctcagctctgcttctcctggttacagtacgagattgcaaaggtcgtttggtgtctgcgcactaaaaacaagaagagattaaaatcacaaggaaagaactgcaaaaaactagccaagaatctcctcaaggagccagacaaccgcaacaatttttgcctctggaagcagtatgcgcatctggagtggttgctcggcaacacagaggatgccagaagagttttcgatacagcgctcggcatggcagggagcagagaactgaaggaccatgagctgtgtgagctcggtctcctctacgccgagctggaggtggagctgttgccggacgtgagaggggctgccccagcccgagccattcacgtattgaccagactgaccgagaatggggcctacgggccctacaccgggcaagtcttggccgttcacattttgaaagctcggaaggcttatgaacacgcgctgcaggactgtttgggggagagctgtgtctctgatccagctcccgccgattcctttagccgcctgattagcctggttaaatgctttatgctcttccagtatttgaccatagggatcgacgctgctgtgcggatatatgagcaggtatttgcgaaacacaaggtctctgtttccgcagagggccctggtctggagggcagtgccagccccccgagcctgagcagtgtccttgaggccgtcaccctgatgcacacgagcctgcttagattccacatgaaagtcgccgtctaccctctggctcctctgcgagaggctctctcggaggctttaaagttgtatccggacaaccaggttctttggaggtcgtatgtacagattcagaataagtcccacagtgccagtaagaccagaagattcttcgatgcgatcaccaggtctgccaaacccttggagccgtggttgttcgcaattgaagctgagaaaatgaggaaaagactagtggaaactgtgcagagatggtagagaggtctacgccaccattcccgagaccggcctgacacatcggatcagagccctgtttgaaaatgcgatgcggagtgactacggcagccagtgccccttactgtggaggatgtatttgaattttttggt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]