LOCUS       XM_029513748            2742 bp    mRNA    linear   VRT 15-JUL-2025
DEFINITION  PREDICTED: Echeneis naucrates argonaute RISC component 4 (ago4),
            transcript variant X8, mRNA.
ACCESSION   XM_029513748
VERSION     XM_029513748.1
DBLINK      BioProject: PRJNA548465
KEYWORDS    RefSeq.
SOURCE      Echeneis naucrates (live sharksucker)
  ORGANISM  Echeneis naucrates
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Carangaria; Carangiformes; Echeneidae; Echeneis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_042521.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_900963305.1-RS_2025_07
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.4
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 07/15/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2742
                     /organism="Echeneis naucrates"
                     /mol_type="mRNA"
                     /db_xref="taxon:173247"
                     /chromosome="11"
     gene            1..2742
                     /gene="ago4"
                     /note="argonaute RISC component 4; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 3
                     Proteins, and 99% coverage of the annotated genomic
                     feature by RNAseq alignments, including 1 sample with
                     support for all annotated introns"
                     /db_xref="GeneID:115050728"
     CDS             181..2742
                     /gene="ago4"
                     /codon_start=1
                     /product="protein argonaute-4 isoform X8"
                     /protein_id="XP_029369608.1"
                     /db_xref="GeneID:115050728"
                     /translation="

MEALGPGPPAPTSLFQPPRRPGLGTVGKPIRLLANHFQVQIPKIDVYHYDIDIKPEKRPRRVNREVVDTMVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDLEVTLPGEGKDQTFKVSLQWVSVVSLQMLLEALSGHLNEVPEDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPVIEFMCEVLDIQNINEQTKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNDMTEVTGRVLPAPMLQYGGRVSTDTGRDCGRGLSPQNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKMSYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQDMSQSLNPTTSLQEQLFSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCSDKAERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKDHDR"

     misc_feature    262..651
                     /gene="ago4"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:465134"
     misc_feature    682..834
                     /gene="ago4"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    835..1197
                     /gene="ago4"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(991..993,1036..1038,1078..1080,1090..1092,
                     1144..1146,1165..1167,1171..1173)
                     /gene="ago4"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1336..2718
                     /gene="ago4"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1795..1797,1807..1809,1843..1854,1861..1863,
                     1885..1887,1894..1896,1906..1908,1918..1920)
                     /gene="ago4"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1999..2001,2005..2007,2272..2274,2686..2688)
                     /gene="ago4"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      

cagtagcagcagcggccgtagctccggtcagtcggtccagtcagcagtcctcggcaccaactgtccgtatccccctttttcttaaattagccactttaagtcttcgcgataccgcccccaatttcagcgtcggtacggagccgccaggccgggacagagacggagagagaggcctcggccatggaagcgctcggacccggcccgcctgcccctacctctctgtttcagcctccgcggcgtcccggcctcggcacggtggggaaacccatccggctccttgccaaccacttccaggtgcagattcccaagattgatgtttatcattatgatattgacatcaagcctgagaaacggcctcgaagggtcaacagggaggtggtggacaccatggtgcggcacttcaagatgcagatctttggagaccgacagcctggctacgacgggaagaggaacatgtacacagcacatccactgccaatagggagggacagggtggatttggaggtgaccctgcctggtgaggggaaggatcagacattcaaggtgtccttgcagtgggtgtctgtggtcagtcttcaaatgctgctggaagccctgtccggtcacctgaacgaggtccccgaagactctgtccaggccctggatgtcatcacccggcacctaccctccatgaggtacactccagtggggcgttcatttttctccccgccggagggctactatcatcctctgggtggaggcagggaggtctggtttggtttccatcagtctgtccgtcctgccatgtggaacatgatgctcaatatagatgtgtcggccactgctttctaccgtgcccagcctgtgatagaattcatgtgcgaagtgcttgatatccagaacatcaacgaacagaccaaaccactgacggactcgcagcgcgtcaaattcaccaaggaaataagaggattgaaagttgaggtcacacattgtggtcagatgaagagaaaatatcgagtgtgcaatgtcacacgccgacctgccagccaccaaacgttccccttacagcttgagaatggccaagccatggagtgcacagtagcccagtatttcaagcagaagtacaacctgcagctcaagtatcctcatttgccttgtctacaagtggggcaggaacagaaacacacctaccttcccctggaggtctgtaacattgtagcaggccagcgctgtatcaagaaattgacagacaaccagacatccaccatgattaaagctacagctcgctcagcccccgacagacaagaagagatcagccgactggtcaaaagcaacagcatggtcggggggccagacccttacctgaaggagtttggcattgtggtgcacaatgacatgacggaggttactgggcgtgtgctccctgcgcccatgctgcagtatgggggccgggtgagtacagacacagggagggactgtggcaggggactctctccacagaataaaactgtggccacgcccaaccagggcgtgtgggacatgcgcgggaagcagttctatgctggcatcgagatcaaggtctgggctgtggcctgcttcgccccacagaaacagtgtcgggaagacctgctcaagagcttcactgaccagctgcgaaaaatttcaaaggatgctgggatgcccattcaaggccagccatgtttctgtaaatacgcccaaggagctgacagtgtggagccgatgtttaaacacctcaaaatgtcttatgtcgggctgcagctgattgtggtcattctgcccggcaaaacacctgtctatgccgaggtgaagagggtgggcgacactctcctcggcatggccacccagtgtgtccaggtgaagaacgtagtgaagacgtcccctcagactctctccaacctctgcctcaagatcaacgccaaactgggaggcatcaacaacgttcttgtgcctcatcagaggccctctgtgttccagcagccagtcatctttttgggggccgatgtgacgcatcctcctgcaggtgacgggaagaagccatccattgcggcagtggtgggcagcatggatggccaccccagcagatactgcgcaacagtgcgagtccagacatcacgacaagacatgtcccagagtctgaatccgacaacgtctttgcaggagcagctcttcagccaagaggtcatccaagacttgaccaacatggtgcgggaactgctcatccagttctataagtccacacgcttcaagcccactcgtatcatctattaccgcggcggcgtgtcagagggacagatgaagcaggtggcatggccagagctgatagcaatccgcaaggcgtgcatcagtctggaggaggattacaggccgggcattacctacattgtggtccagaagcgtcaccacactcgtctattctgctctgacaaagctgagcgggtggggaagagtggcaatgtcccagccggcaccacagtggacagtaccatcacacacccgtccgagttcgatttctacctgtgcagccatgctggtattcagggaaccagtcgtccctcccactaccacgtcctgtgggatgacaactgcttcacagcagatgaactgcagctcctcacctaccagctgtgccacacctacgtccgctgcactcgctccgtctccatcccagcaccggcctactacgccaggctagtggccttccgagcccgataccacctggtggacaaagaccacgacaggtga

//