GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-17 06:21:27, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_025760406            3240 bp    mRNA    linear   PLN 24-MAY-2019
DEFINITION  PREDICTED: Arachis hypogaea protein argonaute PNH1 (LOC112708204),
            transcript variant X4, mRNA.
ACCESSION   XM_025760406
VERSION     XM_025760406.2
DBLINK      BioProject: PRJNA476953
KEYWORDS    RefSeq.
SOURCE      Arachis hypogaea (peanut)
  ORGANISM  Arachis hypogaea
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; fabids; Fabales; Fabaceae; Papilionoideae; 50
            kb inversion clade; dalbergioids sensu lato; Dalbergieae;
            Pterocarpus clade; Arachis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_037618.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On May 24, 2019 this sequence version replaced XM_025760406.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Arachis hypogaea Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3240
                     /organism="Arachis hypogaea"
                     /mol_type="mRNA"
                     /cultivar="Tifrunner"
                     /db_xref="taxon:3818"
                     /chromosome="Arahy.01"
                     /tissue_type="etiolated young seedling"
                     /dev_stage="seedling"
                     /country="USA: Georgia"
     gene            1..3240
                     /gene="LOC112708204"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 EST, 6 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 51 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:112708204"
     CDS             634..2955
                     /gene="LOC112708204"
                     /codon_start=1
                     /product="protein argonaute PNH1"
                     /protein_id="XP_025616191.1"
                     /db_xref="GeneID:112708204"
                     /translation="
MLPFTYKEFTILLTEDDESIGTTREREFKVVIKFAARVSMHQLRELLSGKQVDTPQEALTVIDIVLRELAAQSYVSIGRFLYSPDFRKPQQLGGGLESWRGFYQSIRPTQMGLSLNIDMSSMAFIEPLPVIDFVAQILGKDVHSKPLSDADRVKIKKALRGVKVEVTHRGSFRRKYRISGLTSQPTRELNFPLDEKMNMKSVVDYFQEMYGYTIKYPHLPCLQVGSQKKVNYLPMEACKIVGGQRYTKGLNEKQITSLLKVSCQRPREQETDILQTIQENDYEYNPYAKEFGISVDSKLTSVDARVLPAPWLKYHDTGREKEYLPQVGQWNMMNKKVINGSTVRYWACINFSRSVQESTARGFCQQLVQMCQISGMEFSQDPVIPVYSAKPDLVKKALKYVHSASLENLGGKELELLIAILPDNNGSLYGDLKRICETDLGLISQCCLTKHVFKINRQYLANVALKINVKMGGRNTVLLDALSWRIPLVSDIPTIIFGADVTHPESGEDSCPSIAAVVASQDWPEVTKYAGLVCAQPHREELIQDLFKCWKDPHHGVVYGGMIRELLLSFKKATGQKPLRIIFYRDGVSEGQFYQVLLYELDAIRKACASLEPSYQPPVTFVVVQKRHHTRLFSSNHDDRNSTDKSGNILPGTVVDSKICHPTEFDFYLCSHAGIQGTSRPAHYHVLWDENNFTADEIQSLTNNLCYTYARCTRSVSVVPPAYYAHLAAYRARFYMEPGATEISKARGARSKDGSVRPLPALKEKVKNVMFYC"
     misc_feature    <637..831
                     /gene="LOC112708204"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    859..1011
                     /gene="LOC112708204"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    1012..1356
                     /gene="LOC112708204"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1159..1161,1204..1206,1237..1239,1249..1251,
                     1303..1305,1324..1326,1330..1332)
                     /gene="LOC112708204"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1489..2841
                     /gene="LOC112708204"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1918..1920,1930..1932,1966..1977,1984..1986,
                     2008..2010,2017..2019,2029..2031,2041..2043)
                     /gene="LOC112708204"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(2131..2133,2137..2139,2389..2391,2809..2811)
                     /gene="LOC112708204"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
caccacatacatgtgcgtctcttgaggcttcagcttcttcctcttctcacttcactccaacaacctcacattaattaatctccctcctctgacacactccgatccgcataacacaaatacaacacatacctttctttctttcttagcttgctgggcatcaagtgcgtgcgtgcgtgcgtgcactcctttaatcaccctccctctctgcacacactctttttttatgtatgtgctgaattaaggagagaagagagagagaattttggagaaggtttgaagtgattggatttcacagttatatgcattaaaagctaaggccatagagcagttacaatgaaatatatgcacggcttcagtaataataataataatatcaaatacatgccgtaaactacaaggaaacctattaagcataaacgatgaagtgtgggttgattatgatatgaccagtaggaagctaagaagcagagatagggttgaaggaaagggggggcccctggaaagtgggaaaatttttctgagtaagaaattaactatagatgtgacaaaattgaaagaaagaaagaaagaaatcacattgaccaaagcgtagatcataaaaggagaagcagtcagaaagaatacactgctgccatgcttcctttcacatacaaagagttcactatattattgactgaagatgatgagagtattggtactaccagggaaagagagtttaaggtggtaatcaagtttgctgctcgtgttagcatgcatcaattacgtgagcttctcagtgggaaacaagtggacacaccacaagaagcacttactgttattgacattgttctgagggagcttgcagcacagagttacgtgtccattgggaggtttctgtattctcctgattttagaaaaccacagcagcttggtggtggcttagaatcatggcgtggattctaccaaagtataaggcctacccagatgggtttatcacttaatattgacatgtcatcaatggcgtttattgagccactccctgtgattgactttgttgctcaaattttgggaaaagatgtgcactcaaagccattgtcagatgcagatcgtgtcaagattaagaaggccctaagaggtgtaaaagttgaagttacgcatagagggagttttagaaggaagtacaggatatcaggattgacatcacagccaacaagggagcttaacttccctcttgatgagaaaatgaacatgaaatcagtggttgattattttcaagaaatgtatggatacactatcaagtatcctcatctaccttgtcttcaagtaggaagccaaaagaaggtgaactatttgccaatggaggcatgcaagatagttggaggccagaggtatacaaaagggctaaacgaaaagcagataacttctctcttgaaggtctcatgccagagaccacgcgaacaagagacagatattcttcagacaattcaagaaaatgattatgaatataatccgtatgcgaaagagtttggtataagtgtagacagcaagcttacatcagttgatgctcgggttcttcctgctccatggttgaaatatcatgacactggaagagagaaagagtacttgccacaagttggtcagtggaatatgatgaacaagaaagtaataaatggaagcactgtaagatactgggcatgtatcaatttctcaagaagtgttcaagaaagcacagctcgtggattttgccaacagttagttcagatgtgccaaatctcaggcatggaatttagccaggaccctgtgattcctgtatattcagcaaaacctgatctagttaagaaggctttgaagtatgtacattcagcttctctagaaaatcttggtggcaaggagctagagttgcttattgcaattcttccagacaacaatggctctctatatggtgatctcaaaagaatctgcgaaactgatcttgggttgatttctcagtgttgtcttacaaagcatgtattcaagattaatagacagtacttggcaaatgttgcactcaaaatcaatgtcaagatgggaggaaggaacacagtgcttttggatgctttaagttggaggatcccattggttagtgacattccaacaataatatttggagctgatgtaactcatccagaatccggagaggactcttgtccttccattgctgctgttgtagcctcacaggactggccagaagtaacaaagtacgcaggattggtttgcgcgcagcctcatcgggaagaactcatacaagatctttttaaatgctggaaagatcctcatcatggtgtagtttatggtggcatgatcagagagctcttactctcatttaagaaggcaactggacaaaaaccactgaggataatattttacagggacggggtaagcgaaggacaattctaccaagttttgctatatgaacttgatgccattcgtaaggcttgtgcatctttggaaccaagttaccaacctccagtaacatttgttgtggttcaaaaacgtcatcatactagactcttctcaagcaatcatgatgatagaaatagcactgacaagagtggcaatatcttacctggtactgtggttgattctaagatctgtcatcctacagaatttgacttctatttatgcagtcatgctggaattcagggtacaagtagaccagctcactaccatgtcttatgggatgagaacaatttcactgctgatgaaattcagtctctcaccaacaacttatgctacacttatgcaaggtgtacaagatctgtttcagtagtgcctcctgcatactatgctcatttggcagcataccgagctcgattctacatggaacctggtgccactgagatttctaaagcgcggggtgcaagatcaaaagatggttcagttcggccactcccagctctcaaagaaaaagtcaagaatgtcatgttctactgttgaatatcataagctcaaataaatgagacagagacttcaattgaaattaaacagcaccataggaaaaacaccaagctaaatattagtgatctcatgaaaaactccatcatcatcatcatcatgtacaacaacatatccttgttcatataaattgtatctgattatctctggaaattttgttaagtctagtagcctttttttttcaagtctttgttaccaacacgtgtgatgtagaaattgcttgctttaaagtgcctaaatggtgaaaatcaggttagtatttgtggc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]