2024-04-25 23:56:22, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_025760398 3239 bp mRNA linear PLN 24-MAY-2019 DEFINITION PREDICTED: Arachis hypogaea protein argonaute PNH1 (LOC112708204), transcript variant X3, mRNA. ACCESSION XM_025760398 VERSION XM_025760398.2 DBLINK BioProject: PRJNA476953 KEYWORDS RefSeq. SOURCE Arachis hypogaea (peanut) ORGANISM Arachis hypogaea Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; fabids; Fabales; Fabaceae; Papilionoideae; 50 kb inversion clade; dalbergioids sensu lato; Dalbergieae; Pterocarpus clade; Arachis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_037618.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On May 24, 2019 this sequence version replaced XM_025760398.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Arachis hypogaea Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3239 /organism="Arachis hypogaea" /mol_type="mRNA" /cultivar="Tifrunner" /db_xref="taxon:3818" /chromosome="Arahy.01" /tissue_type="etiolated young seedling" /dev_stage="seedling" /country="USA: Georgia" gene 1..3239 /gene="LOC112708204" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 EST, 6 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 82 samples with support for all annotated introns" /db_xref="GeneID:112708204" CDS 633..2954 /gene="LOC112708204" /codon_start=1 /product="protein argonaute PNH1" /protein_id="XP_025616183.1" /db_xref="GeneID:112708204" /translation="
MLPFTYKEFTILLTEDDESIGTTREREFKVVIKFAARVSMHQLRELLSGKQVDTPQEALTVIDIVLRELAAQSYVSIGRFLYSPDFRKPQQLGGGLESWRGFYQSIRPTQMGLSLNIDMSSMAFIEPLPVIDFVAQILGKDVHSKPLSDADRVKIKKALRGVKVEVTHRGSFRRKYRISGLTSQPTRELNFPLDEKMNMKSVVDYFQEMYGYTIKYPHLPCLQVGSQKKVNYLPMEACKIVGGQRYTKGLNEKQITSLLKVSCQRPREQETDILQTIQENDYEYNPYAKEFGISVDSKLTSVDARVLPAPWLKYHDTGREKEYLPQVGQWNMMNKKVINGSTVRYWACINFSRSVQESTARGFCQQLVQMCQISGMEFSQDPVIPVYSAKPDLVKKALKYVHSASLENLGGKELELLIAILPDNNGSLYGDLKRICETDLGLISQCCLTKHVFKINRQYLANVALKINVKMGGRNTVLLDALSWRIPLVSDIPTIIFGADVTHPESGEDSCPSIAAVVASQDWPEVTKYAGLVCAQPHREELIQDLFKCWKDPHHGVVYGGMIRELLLSFKKATGQKPLRIIFYRDGVSEGQFYQVLLYELDAIRKACASLEPSYQPPVTFVVVQKRHHTRLFSSNHDDRNSTDKSGNILPGTVVDSKICHPTEFDFYLCSHAGIQGTSRPAHYHVLWDENNFTADEIQSLTNNLCYTYARCTRSVSVVPPAYYAHLAAYRARFYMEPGATEISKARGARSKDGSVRPLPALKEKVKNVMFYC"
misc_feature <636..830 /gene="LOC112708204" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 858..1010 /gene="LOC112708204" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 1011..1355 /gene="LOC112708204" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(1158..1160,1203..1205,1236..1238,1248..1250, 1302..1304,1323..1325,1329..1331) /gene="LOC112708204" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1488..2840 /gene="LOC112708204" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1917..1919,1929..1931,1965..1976,1983..1985, 2007..2009,2016..2018,2028..2030,2040..2042) /gene="LOC112708204" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(2130..2132,2136..2138,2388..2390,2808..2810) /gene="LOC112708204" /note="active site" /db_xref="CDD:240015" ORIGIN
caccacatacatgtgcgtctcttgaggcttcagcttcttcctcttctcacttcactccaacaacctcacattaattaatctccctcctctgacacactccgatccgcataacacaaatacaacacatacctttctttctttcttagcttgctgggcatcaagtgcgtgcgtgcgtgcgtgcactcctttaatcaccctccctctctgcacacactctttttttataaggtgctgaattaaggagagaagagagagagaattttggagaaggtttgaagtgattggatttcacagttatatgcattaaaagctaaggccatagagcagttacaatgaaatatatgcacggcttcagtaataataataataatatcaaatacatgccgtaaactacaaggaaacctattaagcataaacgatgaagtgtgggttgattatgatatgaccagtaggaagctaagaagcagagatagggttgaaggaaagggggggcccctggaaagtgggaaaatttttctgagtaagaaattaactatagatgtgacaaaattgaaagaaagaaagaaagaaatcacattgaccaaagcgtagatcataaaaggagaagcagtcagaaagaatacactgctgccatgcttcctttcacatacaaagagttcactatattattgactgaagatgatgagagtattggtactaccagggaaagagagtttaaggtggtaatcaagtttgctgctcgtgttagcatgcatcaattacgtgagcttctcagtgggaaacaagtggacacaccacaagaagcacttactgttattgacattgttctgagggagcttgcagcacagagttacgtgtccattgggaggtttctgtattctcctgattttagaaaaccacagcagcttggtggtggcttagaatcatggcgtggattctaccaaagtataaggcctacccagatgggtttatcacttaatattgacatgtcatcaatggcgtttattgagccactccctgtgattgactttgttgctcaaattttgggaaaagatgtgcactcaaagccattgtcagatgcagatcgtgtcaagattaagaaggccctaagaggtgtaaaagttgaagttacgcatagagggagttttagaaggaagtacaggatatcaggattgacatcacagccaacaagggagcttaacttccctcttgatgagaaaatgaacatgaaatcagtggttgattattttcaagaaatgtatggatacactatcaagtatcctcatctaccttgtcttcaagtaggaagccaaaagaaggtgaactatttgccaatggaggcatgcaagatagttggaggccagaggtatacaaaagggctaaacgaaaagcagataacttctctcttgaaggtctcatgccagagaccacgcgaacaagagacagatattcttcagacaattcaagaaaatgattatgaatataatccgtatgcgaaagagtttggtataagtgtagacagcaagcttacatcagttgatgctcgggttcttcctgctccatggttgaaatatcatgacactggaagagagaaagagtacttgccacaagttggtcagtggaatatgatgaacaagaaagtaataaatggaagcactgtaagatactgggcatgtatcaatttctcaagaagtgttcaagaaagcacagctcgtggattttgccaacagttagttcagatgtgccaaatctcaggcatggaatttagccaggaccctgtgattcctgtatattcagcaaaacctgatctagttaagaaggctttgaagtatgtacattcagcttctctagaaaatcttggtggcaaggagctagagttgcttattgcaattcttccagacaacaatggctctctatatggtgatctcaaaagaatctgcgaaactgatcttgggttgatttctcagtgttgtcttacaaagcatgtattcaagattaatagacagtacttggcaaatgttgcactcaaaatcaatgtcaagatgggaggaaggaacacagtgcttttggatgctttaagttggaggatcccattggttagtgacattccaacaataatatttggagctgatgtaactcatccagaatccggagaggactcttgtccttccattgctgctgttgtagcctcacaggactggccagaagtaacaaagtacgcaggattggtttgcgcgcagcctcatcgggaagaactcatacaagatctttttaaatgctggaaagatcctcatcatggtgtagtttatggtggcatgatcagagagctcttactctcatttaagaaggcaactggacaaaaaccactgaggataatattttacagggacggggtaagcgaaggacaattctaccaagttttgctatatgaacttgatgccattcgtaaggcttgtgcatctttggaaccaagttaccaacctccagtaacatttgttgtggttcaaaaacgtcatcatactagactcttctcaagcaatcatgatgatagaaatagcactgacaagagtggcaatatcttacctggtactgtggttgattctaagatctgtcatcctacagaatttgacttctatttatgcagtcatgctggaattcagggtacaagtagaccagctcactaccatgtcttatgggatgagaacaatttcactgctgatgaaattcagtctctcaccaacaacttatgctacacttatgcaaggtgtacaagatctgtttcagtagtgcctcctgcatactatgctcatttggcagcataccgagctcgattctacatggaacctggtgccactgagatttctaaagcgcggggtgcaagatcaaaagatggttcagttcggccactcccagctctcaaagaaaaagtcaagaatgtcatgttctactgttgaatatcataagctcaaataaatgagacagagacttcaattgaaattaaacagcaccataggaaaaacaccaagctaaatattagtgatctcatgaaaaactccatcatcatcatcatcatgtacaacaacatatccttgttcatataaattgtatctgattatctctggaaattttgttaagtctagtagcctttttttttcaagtctttgttaccaacacgtgtgatgtagaaattgcttgctttaaagtgcctaaatggtgaaaatcaggttagtatttgtggc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]