GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-03-29 23:43:38, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_024202910            2964 bp    mRNA    linear   VRT 15-JUL-2019
DEFINITION  PREDICTED: Terrapene carolina triunguis argonaute RISC catalytic
            component 3 (LOC112108702), mRNA.
ACCESSION   XM_024202910
VERSION     XM_024202910.1
DBLINK      BioProject: PRJNA435426
KEYWORDS    RefSeq.
SOURCE      Terrapene carolina triunguis (Three-toed box turtle)
  ORGANISM  Terrapene carolina triunguis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Testudinata; Testudines; Cryptodira; Durocryptodira;
            Testudinoidea; Emydidae; Terrapene.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_020664587.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Terrapene carolina triunguis
                                           Annotation Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2964
                     /organism="Terrapene carolina triunguis"
                     /mol_type="mRNA"
                     /isolate="2854851"
                     /isolation_source="Kennedy Woods, Forest Park"
                     /sub_species="triunguis"
                     /db_xref="taxon:2587831"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="blood"
                     /country="USA: St. Louis, MO"
     gene            1..2964
                     /gene="LOC112108702"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 45 Proteins, and 99% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="GeneID:112108702"
     CDS             157..2739
                     /gene="LOC112108702"
                     /codon_start=1
                     /product="protein argonaute-3"
                     /protein_id="XP_024058678.1"
                     /db_xref="GeneID:112108702"
                     /translation="
MEIGSAGPVGAQPLLMVPRRPGYGTMGKPIKLLANCFQVEIPKIDVYLYEVDIKPDKCPRRVNREVVDSMVQHFKVTIFGDRRPVYDGKRSLYTANPLPVATTGVDLDVTLPGEGGKDRPFKVSIKFVSRVSWHLLHEVLTGRTLPEPLELDKPISTNPVHAVDVVLRHLPSMKYTPVGRSFFSAPEGYDHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIQFMCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYDADPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"
     misc_feature    373..657
                     /gene="LOC112108702"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    685..837
                     /gene="LOC112108702"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    838..1200
                     /gene="LOC112108702"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(994..996,1039..1041,1081..1083,1093..1095,
                     1147..1149,1168..1170,1174..1176)
                     /gene="LOC112108702"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1333..2610
                     /gene="LOC112108702"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1744..1746,1756..1758,1792..1803,1810..1812,
                     1834..1836,1843..1845,1855..1857,1867..1869)
                     /gene="LOC112108702"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1948..1950,1954..1956,2164..2166,2578..2580)
                     /gene="LOC112108702"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
gggaggccgcccagctgccgttgcttcacagccccgctccccgggccggccggccggacccggcgccgcggggagagagggggccgcgcccggcccggtggggagaggcaggatcctgatcccgcagcctgagaacggccgcccccagctccatgaatggaaatcggcagcgcaggacccgtcggggcacagccccttcttatggtgcccagacgtcccggctatggcaccatgggcaaacctattaaattgctggccaactgcttccaagttgaaatcccaaagattgatgtctacctctatgaggtggatattaaaccagataagtgtcctcgcagggtgaacagggaggtggtggactccatggtgcagcattttaaagtgacaatatttggggaccgtagaccagtttatgatgggaagagaagcctttatacagccaatccactccctgtagcaaccactggggtagatttggatgtaacattaccaggagaaggtggaaaagatcgtcccttcaaggtgtcaataaagtttgtttctcgggtgagctggcacttgctgcatgaagttttgacaggaagaaccttgcctgagcctctggaactagacaaaccaatcagcactaaccctgttcatgctgtcgatgtggtgctacgacacctaccctccatgaagtatacccctgtgggccgctcctttttctcagctccagagggctatgatcaccctttgggagggggcagggaagtatggtttggattccatcagtctgttcggcctgccatgtggaaaatgatgcttaatattgatgtttctgccactgccttctacaaagcacaacctgtaattcagttcatgtgtgaagttctcgacattcataacattgatgaacaaccgagacctctgactgattctcatcgggtaaaattcaccaaagagataaagggtctgaaggttgaagtgactcactgtggaacaatgagacggaaataccgtgtttgtaatgtaacaaggagacctgccagtcatcaaaccttccctttacagttagaaaacggccagacagttgagagaacagtagcacagtacttcagagagaagtataacctccagctgaaatatcctcatcttccttgtctacaagtgggacaggagcagaaacatacctacctgcctctagaagtatgtaacattgtggcaggccagcgatgtatcaagaagctaacagacaatcagacatcaactatgataaaagcaacagcaagatctgccccagatagacaagaggaaattagcagattggtaagaagtgcaaattatgatgcagatccatttgttcaagagtttcagtttaaagttcgggatgagatggcccatgtgactgggcgtgtgcttccagctccaatgttgcagtatggaggacggaatcgaacagtggcaaccccaagccatggcgtatgggatatgcgagggaaacagtttcacactggtgttgagatcaaaatgtgggccatagcttgctttgcaacgcagagacaatgcagagaagaaatactgaagggttttacagatcagctgcgcaagatttcgaaggatgcagggatgcccatccaaggccagccatgtttttgcaaatacgcacagggtgcggacagcgtggagccgatgttccgacaccttaaaaacacctattcaggactccagctcatcattgtcatcctgccagggaaaacacctgtgtatgccgaggtgaaacgtgtgggagatacgctgttggggatggccacgcagtgcgttcaagtcaagaatgtcataaaaacatctcctcagactctctcaaacctgtgcctaaagattaatgttaaattaggaggaatcaacaacattcttgtacctcatcaacgaccttctgtgttccaacaaccagtgatcttcttgggagcagatgtcactcatccgcctgctggggatggaaagaagccttccattgctgctgttgtaggtagtatggatgctcatccaagcaggtattgtgccacagtgagagttcaaaggcctcggcaggagattatccaagatttggcctccatggtaagagaacttctcatccagttctacaagtcaacacgattcaaacccacacgtatcatcttctacagggatggggtttctgaaggacagtttcgacaggtgttgtattatgagctgctagcaattagagaggcctgcatcagtctggagaaagattaccagccaggaataacctacatcgtagtacagaaacgacaccacacacgattgttctgtgcggacagaactgaaagggttggaagaagtggcaacattccagctggaacaactgtagatacagatattacacacccatacgagtttgatttttacctctgtagccatgctggaatacagggtaccagccgtccctcacactatcatgttttgtgggatgataactgttttactgcagatgaacttcagctgctgacttaccagctatgccacacatatgtgcgttgcacacgatctgtttctatacctgcaccagcgtattatgctcacctggtagcattcagagcacgataccatcttgtggacaaagaacatgacagtgctgaaggaagccatgtttcaggacaaagcaatgggagagacccacaggcccttgctaaggctgtacagattcaccaagacaccttacgcaccatgtacttcgcttaaataaatcaataaaatcggagcatactcactgaaaggaagaactgaaaaattaagccacatacaatgtatgtttccggtggggtcagtttatggggtgcgcctccgatcacgctgaagccgacactgtgcaggggcaaggggctaatccttaaattgacacgtggaggattgtttacttcatcgaggaacacagcactattatgcaatatgaaaccagccaactgc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]