GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-02 13:38:42, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_023490768            2604 bp    mRNA    linear   INV 16-OCT-2023
DEFINITION  PREDICTED: Eurytemora carolleeae protein argonaute-4
            (LOC111715445), transcript variant X2, mRNA.
ACCESSION   XM_023490768
VERSION     XM_023490768.1
DBLINK      BioProject: PRJNA423276
KEYWORDS    RefSeq.
SOURCE      Eurytemora carolleeae
  ORGANISM  Eurytemora carolleeae
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Crustacea;
            Multicrustacea; Hexanauplia; Copepoda; Calanoida; Temoridae;
            Eurytemora.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_019397675.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_000591075.1-RS_2023_10
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 10/05/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2604
                     /organism="Eurytemora carolleeae"
                     /mol_type="mRNA"
                     /db_xref="taxon:1294199"
                     /chromosome="Unknown"
     gene            1..2604
                     /gene="LOC111715445"
                     /note="protein argonaute-4; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 12
                     Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 49 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:111715445"
     CDS             43..2589
                     /gene="LOC111715445"
                     /codon_start=1
                     /product="protein argonaute-1 isoform X2"
                     /protein_id="XP_023346536.1"
                     /db_xref="GeneID:111715445"
                     /translation="
MKTEINITELNIFTESIITDYTPPDSRECSNSPPSRPASPPTKRKFHAQRRPALGQEGKPISLRANHLEVSVKPGYIYQYNVNITPGGCPRRVNREIVKTMVDAYTAIWRTSMGPILPVYDGRESLYTIEPIPSVEDKENLELQVTLAAHDGRERSFMVMVSYEQKISLYDLLSSIEGRLREVPEDAAFALDVVMRHLPSMLYTPVGRSFFSPPTNYFHPLGGGREVWFGFHQSVRPSHWKMTLNIDVSATAFYKGQSVVEFASELLDLRNLESGVQLNDTQRSRLAKELKGLKVEITHSQIARKYRVCNLTRRSAQMQCFPLQLENGQTVECTVSKFFMDKYRMKLRYPGLPCLQVGQEHKHTYLPMEVCRIVAGQRCLKKLTDLQTSTMIKATARSAPDREREIRNLITKADFNNDPYVKKFGLDVSQRMMETQGRVLNPPKLEYGSRSARTFTVPSQGVWDMRGKQFYEGMTIKHWAIACFTPQQSVKPQDLKLFVDRLSQISSDLGMRIIREPCFCKYIHDATSVMPMFNFLKKEFPELQLIVVVLPGKTPVYAEVKRMGDSVLGIATQCIKSKNVTRTTAQMLSNLCLKINAKLGGINTILVPENRIRIFSEPLMFLGATVTHPPAGDTKKPSIAALVASVDAHPSLYSAVVRIQMARMDVINALYEMVKESLVNFYVKTGFKPHRIVMYRDGVSEGQFASVLQNELLAIRKACVSLETDYRPGITFIVVQKRHHTRLFCANPRDQSGRSGNVPAGTTVDSNITHPTENDFYLCSHQGIQGTSRPSYYRCLWDDNQLTADELQTMTYSLCHTYARCTRSVSIPAPAYYAHLVAIRARYHIIGN"
     misc_feature    394..627
                     /gene="LOC111715445"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    655..807
                     /gene="LOC111715445"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    811..1164
                     /gene="LOC111715445"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(958..960,1003..1005,1045..1047,1057..1059,
                     1111..1113,1132..1134,1138..1140)
                     /gene="LOC111715445"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1297..2577
                     /gene="LOC111715445"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1711..1713,1723..1725,1759..1770,1777..1779,
                     1801..1803,1810..1812,1822..1824,1834..1836)
                     /gene="LOC111715445"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1915..1917,1921..1923,2131..2133,2545..2547)
                     /gene="LOC111715445"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
atatgagataatttcagaatagaaaatatttacttcaacacaatgaaaactgagataaacataacggagctgaatattttcacagaatctattataacagattatactcccccggactcaagggagtgttctaactctcctccctccagaccagcctccccgcccactaaacggaagtttcatgcccaacgcaggcctgcgctagggcaggagggtaaacccatttctctcagagcaaatcatttagaggtatctgttaaacccgggtacatataccagtacaacgtcaacattacacctggtggatgtccaagacgtgtgaatcgtgaaattgtaaaaactatggtggatgcttatacagccatatggagaacttcaatgggtcctattctccctgtatatgatggtagagagagcctgtatactattgaacctataccaagtgtagaggataaggagaatcttgaactccaggtaaccctagcagcgcatgatgggagggagagatcttttatggtcatggtctcttatgagcaaaagatctccttgtatgatctgctgtctagtattgaaggtcgtcttcgagaagtgccggaagatgctgcttttgctttagatgttgttatgcgacacctacctagtatgctgtatactcccgtagggcgttcgttcttttccccgcctaccaactatttccacccccttggagggggtagagaggtttggtttggttttcaccaatctgttcggccttcacactggaagatgacgcttaacatagatgtctctgcaacagctttctacaaaggacaatcagttgtggagtttgcttcagagttgctagatctcagaaatcttgaatctggtgttcaactcaacgacacccagcgctctaggcttgccaaagagttgaaaggactgaaggtggagatcacccattctcagattgcgcgcaaataccgcgtttgcaatcttacgcgacgaagtgcgcagatgcaatgctttccgcttcagctggagaacggtcaaactgtggagtgtactgtgtcaaagttcttcatggacaaatacaggatgaaactaagatatccaggtctaccctgtctccaggttggacaggagcacaagcatacctatctacccatggaggtatgtcgtatagtagctgggcagagatgtttgaagaagttgaccgacctacagacctcaactatgatcaaggcaaccgctagatctgctccagatagagagagagaaattaggaatctaatcaccaaagctgatttcaacaatgatccctatgtgaagaagtttggtctggatgtatcccaaagaatgatggaaacccagggtagggttctgaaccctcctaaactggaatatggttccaggagtgccagaacattcacagtgcccagtcaaggagtttgggacatgcgaggaaaacagttctatgaagggatgacaattaaacattgggcaattgcctgctttacacctcagcagtcagtcaaaccccaggatctgaagctgtttgttgaccgtctaagccagatctccagcgacctgggaatgaggataatcagagaaccctgcttctgtaaatatattcatgatgctaccagtgttatgcccatgttcaacttccttaagaaagagttccctgagttgcagctgattgttgttgtactccctgggaaaactcccgtctatgctgaagtcaagagaatgggggacagtgttttaggaattgcaacccagtgtatcaagtccaagaatgtgacccggacaactgcccagatgttgtcgaacctatgcttgaagatcaacgctaagctgggggggataaacaccatcctagttccagagaacaggatcaggatattcagtgagcctctgatgttccttggagctactgtgacccatcccccagctggagacacaaagaagccaagcattgctgctcttgttgcctcagttgatgctcatccatcattgtacagtgctgtagtcaggatacaaatggcaaggatggacgtgatcaatgctttgtatgagatggttaaagagtccttggtcaacttctatgtcaagactggattcaaacctcataggattgtgatgtaccgtgatggtgtttcagagggtcaatttgcttctgtacttcaaaacgaactgcttgccattaggaaagcttgtgtatccctggagacggattaccggcccggcatcaccttcattgttgtacagaagaggcatcacacacggctgttctgcgccaatccaagggatcagtcgggacggtccggtaatgtaccggcaggaaccactgtggattctaacatcactcacccaacagagaatgatttctatctctgttctcatcaaggaatccagggcactagtcgaccctcctactaccgttgtttgtgggatgataatcagctgactgctgatgaattgcagaccatgacctactctctctgccatacatacgccagatgtacaagaagtgtttctatccctgctcccgcttactacgctcatctagttgccatcagagcaagataccacatcataggcaattgatttgtttagatacca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]