ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-07-04 13:22:39, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_020761822 2833 bp mRNA linear INV 10-APR-2017 DEFINITION PREDICTED: Orbicella faveolata protein argonaute-2-like (LOC110055433), partial mRNA. ACCESSION XM_020761822 VERSION XM_020761822.1 DBLINK BioProject: PRJNA381078 KEYWORDS RefSeq; includes ab initio. SOURCE Orbicella faveolata ORGANISM Orbicella faveolata Eukaryota; Metazoa; Cnidaria; Anthozoa; Hexacorallia; Scleractinia; Faviina; Merulinidae; Orbicella. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_018149549.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Orbicella faveolata Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 1% of CDS bases ##RefSeq-Attributes-END## COMPLETENESS: incomplete on the 5' end. FEATURES Location/Qualifiers source 1..2833 /organism="Orbicella faveolata" /mol_type="mRNA" /isolate="FL" /db_xref="taxon:48498" /chromosome="Unknown" /sex="hermaphrodite" /tissue_type="whole organism" /dev_stage="adult" /geo_loc_name="Panama" /collection_date="Aug-2013" /collected_by="Nancy Knowlton" /identified_by="Nancy Knowlton" gene <1..2833 /gene="LOC110055433" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 35 Proteins, and 96% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:110055433" CDS <1..2091 /gene="LOC110055433" /codon_start=1 /product="protein argonaute-2-like" /protein_id="XP_020617481.1" /db_xref="GeneID:110055433" /translation="
LPTENSKDKTFKVTVKWVAQVSLFALEQALEGKHNQIPFETIQALDVVLRHLPSMKYTPVGRSFFSPPDGYYHPLESGREVWFGFHQSVRPSQWKMMLNIDVSATAFYKCQPVVEFMCEVLRKQQQELHQHKPLSDAERLKFTREIKGLKVEITHCGTTKRKYRVINVTKLPAQTLKFPLKQSEAGQAQEITVAKYFQEKHVKQLQFPHLPCLQVGQEQKHTYLPLEVCNLVAGQRCIKKLSDMQTSKMIRATAKKAPDREQEIVNLVRKADFNNDQYVQDFGISINDRMVELEGRVLIAPKLQYGGKDKIKISPRQGAWDMRGKQLFHGIEIKVWAIACFVSPQDCNDRALKSFAHQLMKISGETGMPIRSEPCFCKYAKKPTDVEPMFKHLMATFSNLQLIILVLPGKTPVYAEVKRVGDTMLGIATQCVQSKNVMKLNPQTISNLCLKINAKLGGINSILAPDVRIAAVVGSMDAHPSRYCASVRVQTHRQEIIAELAAMVRELLIQFYRSTRHKPVRIIFYRDGVSEGQFRQVLCHELKAIREACIKLEVGYQPGITFVVVQKRHHTRFFCQDEKDRCGNSGNVPPGTTVDIGITHPTEFDFYLCSHAGIQVKISNILSEVNQRQRPGPQYTGDIHMSIGHCAQNPDMILLFYCSHDNGSSCSGGHGDERSPQILAKAVQVHSEMLKGMYFA"
misc_feature <19..147
/gene="LOC110055433"
/note="N-terminal domain of argonaute; Region: ArgoN;
pfam16486"
/db_xref="CDD:465134"
misc_feature 175..327
/gene="LOC110055433"
/note="Argonaute linker 1 domain; Region: ArgoL1;
pfam08699"
/db_xref="CDD:462567"
misc_feature 331..696
/gene="LOC110055433"
/note="PAZ domain, argonaute_like subfamily. Argonaute is
part of the RNA-induced silencing complex (RISC), and is
an endonuclease that plays a key role in the RNA
interference pathway. The PAZ domain has been named after
the proteins Piwi,Argonaut, and Zwille; Region:
PAZ_argonaute_like; cd02846"
/db_xref="CDD:239212"
misc_feature order(487..489,532..534,577..579,589..591,643..645,
664..666,670..672)
/gene="LOC110055433"
/note="nucleic acid-binding interface [nucleotide
binding]; other site"
/db_xref="CDD:239212"
misc_feature 829..1845
/gene="LOC110055433"
/note="PIWI domain, Argonaute-like subfamily. Argonaute is
the central component of the RNA-induced silencing complex
(RISC) and related complexes. The PIWI domain is the
C-terminal portion of Argonaute and consists of two
subdomains, one of which provides the...; Region:
Piwi_ago-like; cd04657"
/db_xref="CDD:240015"
misc_feature order(1240..1242,1252..1254,1288..1299,1306..1308,
1330..1332,1339..1341,1351..1353,1363..1365)
/gene="LOC110055433"
/note="5' RNA guide strand anchoring site [active]"
/db_xref="CDD:240015"
ORIGIN
cttccaactgaaaacagcaaagacaagacattcaaagtgacagtcaaatgggtcgcacaagtaagcttgtttgccctggaacaagcattagaaggaaaacacaatcagattccgtttgagaccatccaggctctggatgttgtgttgcgccacttgccatccatgaagtatacccctgtggggagatctttcttttctcctccagatggctattaccacccactagaaagtgggcgtgaggtttggtttggctttcatcagagtgtgcgaccgtcacagtggaagatgatgctgaatattgatgtgtcagcaacagcattttataagtgtcagcctgtagtcgagttcatgtgcgaagttcttcgtaaacagcaacaggaacttcaccagcataagccgctatctgatgcagaaagactgaagttcaccagggagatcaaaggtttgaaggttgagatcacacactgtggtactacgaagagaaagtatcgggtaatcaatgtcacaaaactaccagcacaaactctgaagtttcctctcaagcagtcagaagcagggcaggcccaggagatcacagtggcaaagtattttcaggaaaaacacgtgaaacaactccaattcccccacctgccttgtcttcaggtcggacaggaacagaaacacacctacctacctttagaagtttgtaaccttgttgctggacagcgctgcatcaagaagttgtctgacatgcagacgtccaagatgatcagagctactgcaaagaaagctcctgatagagaacaggaaattgtaaatctggttaggaaagcagattttaacaacgaccaatatgttcaagattttggcatctcaataaatgacagaatggttgaactcgaaggtcgtgttcttatcgcccctaaactacaatatggaggaaaggacaaaataaagatttctccaagacaaggtgcctgggacatgcgaggaaagcagctgtttcacggcatcgagataaaggtctgggcgattgcttgctttgtaagtcctcaagactgcaacgacagagctttgaagagcttcgcgcatcagttgatgaagataagtggcgaaactggaatgcccatcagatctgagccttgtttctgtaaatatgccaagaaacctacagatgttgaaccgatgttcaagcacttgatggcgacgtttagcaatttacagcttattatcctcgtcttacctggaaaaactccagtctatgctgaagtcaagcgtgttggggatacaatgttgggtattgctacacagtgtgtgcagtcgaaaaatgtcatgaaattaaacccacaaaccatttccaatctctgcctcaaaatcaacgctaagcttggtggaataaacagcatcctcgctcctgatgtgcgaattgctgctgttgtcggcagtatggatgcccatcctagccgatattgtgcttctgtgcgagtgcaaacgcatcgacaggaaatcattgccgagttagccgccatggtacgggagctgttgattcagttttatcgctcgacgagacacaaaccagtgcggattattttttatcgagatggagtgagtgaagggcagtttagacaggtcctgtgccacgaactgaaggcaatccgcgaggcttgcatcaagctggaggttgggtaccagcctggaatcacgttcgttgtggtccaaaagcgacatcacacacgattcttctgtcaggacgaaaaagaccggtgtggcaacagtgggaatgtccctccaggtaccactgtggatatcggcatcacacatcccactgagtttgacttctacctgtgcagtcacgcaggtattcaggtaaagataagcaatatactctcagaagttaaccagagacagaggcccggtccacaatacactggagatattcatatgagtattgggcattgcgcacaaaatcctgacatgatacttttgttttattgtagtcacgacaacggttcatcgtgtagcggtgggcatggagatgaacgaagtccgcagatattggccaaagctgttcaagttcactctgaaatgttgaaagggatgtactttgcctgagggcactctgtgtgatatacacaacacttacaaccacgactcttttagactatttattctttttgacaatgtggcaaatacttcatgtatctaccctgtggtgtagttttatctcttttactataaaatgttcgccgtatttttggctttaagacacctatttgaaaaacaagcgaacatgttgtttctttgaaagaaatcagatgaggaaagtagaattcttgaagactgggtttgcttagatgcgcttctccatttcttttccgcgcgcgcttcttgtgatgaagtgtgatatgcaaattagctatgaaatggtatctaatgcgcatgtgcaccagctgactgtgtccctttaagaaacacttggattgaaaatcactgattatgtcggctcgactataaaatttttatagagcatataagttagcctaatgtatttttaaaactttcgttacaatgaattctgtaagtgtgatataatgatctagaaaatttttagagtaggttttatcgtgctgtgcacgtcatacttagaatttaggtcagtactctatccaatcgtcattttaagattacaagtagcacattgcctaagaggtgatttatgaaatatatgtcaaagcaacaaaacaaattgaaataaataacgtgtaacttgaacctaagttgtgtgagaagaagcggaaagtacttttccaaaactacctgcattctaacaataaaaagcaccaaggaccgtaca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]