2025-10-20 13:13:47, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_020720308 2704 bp mRNA linear PLN 10-APR-2017 DEFINITION PREDICTED: Phalaenopsis equestris protein argonaute MEL1-like (LOC110021710), mRNA. ACCESSION XM_020720308 VERSION XM_020720308.1 DBLINK BioProject: PRJNA382149 KEYWORDS RefSeq. SOURCE Phalaenopsis equestris ORGANISM Phalaenopsis equestris Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Asparagales; Orchidaceae; Epidendroideae; Vandeae; Aeridinae; Phalaenopsis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_018164582.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Phalaenopsis equestris Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2704 /organism="Phalaenopsis equestris" /mol_type="mRNA" /db_xref="taxon:78828" /chromosome="Unknown" gene 1..2704 /gene="LOC110021710" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 58 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 3 samples with support for all annotated introns" /db_xref="GeneID:110021710" CDS 370..2625 /gene="LOC110021710" /codon_start=1 /product="protein argonaute MEL1-like" /protein_id="XP_020575967.1" /db_xref="GeneID:110021710" /translation="
MSRDRTFNISINFVKSLDQYALAQFLSGRQTECPQDIITALDIVLRESASNKYVTVSRSFFSHQFGKMDMSGGLECWRGYFQSIRPTQMGLSLKSLNADTSATPFYKSMSILTFISGFYNERHTLTSLSDRERHEIQKALNGVRVETVHLPNVRRRYRITGITSQSAKELMFTLDETAGTKISVAQYFRTHCKYNLRHDSLPCIKAGSDSKPKYLPLEVCQIVDGQRYVKKLNEVQVSEILKVACTPPTEREGKILELVRKNNYDNDLFAKNFGIGVQPNLITVEARVLQPPRLKYHDSGAEKGCQPFGGKWSMNNKKVFRGGSVDAWACISFSRHYKNIVQDFCHEIVFACNRIGMVFNQNALIIDSGHHQRIENSIHDFVKACAKPLQLLVVILPEAKGAYGRIKKYCDTELGIVTQCCQSKHLNKPNRQYFENLALKINVKAGGCNTVLEDSVRGSIPVISEEPSIIFGADVTHPAPGEDSSSIAAVVASMDWPYVTKYKCLLSAQQRTREIIEKLYTKTDDGVPGGMIRELLFAFHKATGRKPNRIIFYRDGVSEGQFNIVLTSELDAIRRACASIQEGYLPPTTFIVVQKRHHTRLFPENTKMADRSGNILPGTVVDTKICHPNEFDFYLCSHAGIQGTSRPAHYHVLHDENNFTADQLQSLTNNLCYTYARCTRSVSIVPPAYYAHLAAFRARYYIDTGSEYASSQVSGKTRQRTATASAATTSAAPTTGLPAIPENVANVMFYC"
misc_feature <376..504 /gene="LOC110021710" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:465134" misc_feature 532..690 /gene="LOC110021710" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:462567" misc_feature 691..1038 /gene="LOC110021710" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(838..840,883..885,919..921,931..933,985..987, 1006..1008,1012..1014) /gene="LOC110021710" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1174..2475 /gene="LOC110021710" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1576..1578,1588..1590,1624..1635,1642..1644, 1666..1668,1675..1677,1687..1689,1699..1701) /gene="LOC110021710" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1789..1791,1795..1797,2032..2034,2443..2445) /gene="LOC110021710" /note="active site" /db_xref="CDD:240015" ORIGIN
tgttgaaaaatctctagaaaatgctgcattattggtctactttttatttaggatccactagaaaattatggtgctaatctctccactaccatccatggaggcgatgcagattttcatgaactactgggtagcaaggaatatagaggctatgtatagaaaaaaatagtagcgtggcaagctaacagctcaggttggggacagatgtgtctcgactatagaaacagagaagtacgatataggcaaagagatgagcaacgcaagctacatctgtatagttaattacacacacaacacaaatccccctacccatctcttccagatcttattccacgtgtgtatttcagtcctaatcatctaggttctctttgcatgagccgggacagaacattcaacatttctatcaattttgtaaaatccttggatcagtatgctctagcacagtttttgagtgggaggcagacggaatgccctcaggatatcataactgctttggatattgtcctccgagagtctgcctcaaataagtacgttacagtttcaagatcattcttttcacatcagtttgggaaaatggatatgtctggaggtttagaatgttggaggggttatttccaaagcattcgaccaacacaaatgggcttatccttgaaatccttgaatgctgatacctctgcaacacctttctacaagtcaatgagcatattaacctttatctcgggtttttataatgaacgacatacgcttacaagtttatctgatagggaacgtcatgagatacaaaaggcgttgaatggagtccgggtggaaacagttcatttaccaaatgtgcgtagacgctatagaatcacaggaattacatcacagtctgctaaagagttgatgttcactcttgatgaaacagcgggaactaaaatatctgtggcccaatactttagaacacattgcaagtataatcttaggcacgattcactaccatgcattaaagccggtagtgatagcaagccaaaatacttgccactagaggtatgccaaattgtggatggacagaggtatgttaagaagttaaatgaagtgcaagttagtgaaatactaaaagtagcttgtacgcctccaactgagagggaggggaaaattttggagctggtcaggaaaaataattatgacaatgatctatttgcaaaaaactttggtattggggttcaacctaatcttatcacagttgaagcacgagtgctacaaccgccaagactgaagtatcacgatagtggcgctgagaagggctgtcaaccctttggggggaaatggagtatgaataataagaaagtgtttcgaggcggtagtgttgatgcttgggcatgcataagcttttctcgtcattataagaatatcgttcaagatttctgccatgagatagtcttcgcgtgcaaccgcattggaatggttttcaatcaaaatgctttgatcatcgattcaggtcaccatcaacgtatagaaaatagcatacatgattttgtgaaagcgtgtgctaagccgcttcaattgctagttgttattcttccagaggctaagggtgcatatggcaggataaaaaaatattgtgatactgagcttggtattgtcactcagtgttgccagtcaaagcacctaaacaagccaaatagacaatactttgaaaatttagctttgaaaatcaatgtgaaggctggtggctgtaatactgttcttgaagattctgtcagaggttcaatccctgtcatatccgaagagccttctattatatttggagctgatgtcacccatccggcccctggagaagactcttcctccattgctgcggtggttgcatctatggattggccctacgtaacaaagtacaaatgtcttttatctgcacaacaacgtacaagagaaattatagagaagctctatacaaagactgacgatggagtgcctgggggaatgataagggagcttctttttgcgttccataaagcgacaggccgtaaaccaaatcgcatcatattctacagggatggtgttagtgaaggccaattcaacattgtgcttacatcggaactggatgctattcgaagagcttgtgcctcaatacaagaaggatatcttccaccaactacatttatagtggtgcagaagagacaccatactcgtttatttcctgagaatacaaaaatggctgataggagcgggaacattttgccaggtacggtagtcgatacaaagatttgccatcccaatgagttcgacttctacctttgcagtcatgctggtattcagggcacaagtcgtcccgctcattatcatgttctccatgatgaaaacaattttactgctgatcagttgcagtcgctaaccaataacttatgctacacatatgcccgatgcacgcgctctgtttctattgttcctcctgcatattatgcgcatcttgcagcattccgggctcgatattacatagatacagggtctgaatatgcatcaagtcaagtcagtggaaaaacacgccaacgaactgcaaccgcttcggcagctaccacatcagccgcacccacaactggtctcccagctattccagaaaacgtcgcaaacgtgatgttttactgttagaagatgagcagctcgatgaattaaaaaatatgggagatttgcatgcatatcacaacattttacatatttacgtataaac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]