GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-25 21:06:11, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_015824155            3017 bp    mRNA    linear   VRT 23-MAY-2019
DEFINITION  PREDICTED: Protobothrops mucrosquamatus argonaute RISC component 4
            (AGO4), mRNA.
ACCESSION   XM_015824155
VERSION     XM_015824155.1
DBLINK      BioProject: PRJNA313429
KEYWORDS    RefSeq.
SOURCE      Protobothrops mucrosquamatus
  ORGANISM  Protobothrops mucrosquamatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata;
            Toxicofera; Serpentes; Colubroidea; Viperidae; Crotalinae;
            Protobothrops.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_015388239.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Protobothrops mucrosquamatus
                                           Annotation Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3017
                     /organism="Protobothrops mucrosquamatus"
                     /mol_type="mRNA"
                     /isolate="PMUCROS"
                     /db_xref="taxon:103944"
                     /chromosome="Unknown"
     gene            1..3017
                     /gene="AGO4"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 42 Proteins, and 97% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:107294886"
     CDS             81..2465
                     /gene="AGO4"
                     /codon_start=1
                     /product="protein argonaute-4"
                     /protein_id="XP_015679641.1"
                     /db_xref="GeneID:107294886"
                     /translation="
MVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDMEVTLPGEGKDQTFKVSVQWVSVVSLQMLLEALAGHLNEVPEDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPIIEFMCEVLDIQNINEQTKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYSLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNEMTELTGRVLPAPMLQYGGRNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKLTYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQETSQELLYSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCADKTERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYQVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKDHDSAEGSHVSGQSNGRDPQALAKAVQIHHDTQHTMYFA"
     misc_feature    90..344
                     /gene="AGO4"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    375..527
                     /gene="AGO4"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    528..890
                     /gene="AGO4"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(684..686,729..731,771..773,783..785,837..839,
                     858..860,864..866)
                     /gene="AGO4"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1029..2336
                     /gene="AGO4"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1440..1442,1452..1454,1488..1499,1506..1508,
                     1530..1532,1539..1541,1551..1553,1563..1565)
                     /gene="AGO4"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1644..1646,1650..1652,1890..1892,2304..2306)
                     /gene="AGO4"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
aaattgatgtttatcattatgacgtggatatcaaaccagaaaaacgtccccggagagtgaatagggaggttgtggatactatggtgagacacttcaagatgcaaatatttggggatcgacagcctggctatgatggcaaaagaaatatgtatactgcgcatcctttgcctattggaagagacagggtggatatggaggtcacactcccgggcgaagggaaggaccagacctttaaagtgtcagttcagtgggtgtctgtagtcagccttcagatgctcctggaagctttggcagggcatctgaacgaagtcccagaagactctgtgcaggcattagatgttatcacacggcatcttccctctatgaggtacactccagtggggcgttccttcttctctccccctgaaggatactaccacccgctgggaggaggccgagaggtctggtttggcttccatcagtctgtcagacctgccatgtggaacatgatgctcaatatagatgtatcggcaactgctttctaccgtgctcagcctattattgaattcatgtgcgaggtcctggatattcaaaacatcaatgaacaaacgaaaccccttacggattcccagcgtgttaaatttaccaaagaaatcagaggtttaaaagtggaggttactcactgcggtcagatgaaaagaaaatacagagtttgcaatgttactagacgacctgcaagccatcaaacgttccctctgcagttggaaaatgggcaagctatggaatgtacagtagctcagtactttaagcagaagtacagtctgcaactgaaatacccacatcttccatgcctccaagtagggcaagagcagaaacatacatatctaccccttgaggtgtgtaatatagttgcaggacagcgctgtattaagaagctgacagacaatcagacatcaactatgatcaaagcaacagcacgatctgcacctgacaggcaggaggaaattagcagacttgtcaagagtaacagtatggttggcggacctgatccatatctgaaggagtttggtattgttgtccataatgaaatgacagaactgacaggcagagtattacctgcacctatgctgcagtatggaggtaggaacaagactgttgctacaccaaatcagggtgtctgggatatgagaggaaaacagttctatgctggcattgaaattaaagtgtgggctgtcgcttgctttgcacctcagaaacaatgtcgggaagatttgctgaagagttttactgatcagctgcgcaagatctctaaggacgcggggatgccaatccagggccagccatgcttctgtaaatacgcacaaggggcagacagcgtggagcccatgttcaaacatttgaaattgacttatgtggggctgcagctaattgtagtcattcttccaggaaagacacctgtctatgctgaagttaaacgagtcggggataccctcctgggcatggccacccagtgtgttcaggtgaaaaatgtggtgaaaacatctccccaaacactgtccaatctttgtctcaagatcaacgcaaaacttggtggaataaacaatgtccttgtaccacatcaaaggccctcggtattccagcaacccgttatttttctgggagcagatgtcactcacccacctgctggagatgggaagaaaccttccattgctgctgtagtcggaagcatggatggccaccccagccgctactgcgctactgtgcgagtgcaaacatcccgccaagagacatcccaggaactgctgtacagtcaggaagtgattcaggacctgaccaatatggtgcgagaactgctgatccagttttacaagtccactcgcttcaagcccacacggatcatttactatagaggaggagtatccgaagggcaaatgaaacaggtagcttggcctgagcttattgcgatccggaaggcctgcatcagtttagaagaagactaccgaccaggaatcacctacattgtcgtgcagaaaaggcatcacacgagactcttttgtgcagacaaaactgaacgggtggggaaaagtggaaatgttccggcaggtactaccgtggatagcaccatcacccacccatctgaatttgacttttacctctgtagccatgcaggaatccagggaaccagccgtccttctcactatcaagtcttgtgggatgacaactgtttcaccgcggatgaattgcagctactgacataccagctgtgtcacacttacgtgcgatgcacgcggtctgtctcaatccctgcgcctgcatattacgctcggctagtggcattcagagcaagataccatctggtagacaaagaccacgacagtgctgaaggcagccacgtgtcaggacagagcaatggccgtgaccctcaagcactagccaaggcagtgcaaatccaccacgacacccagcacactatgtattttgcctgataggactctgcagccacgtggcaggagtggcctagttggtcaggccaccaaccatccgtagtcagggctcgtttttaacgcaggctgccctccaccagcagcttgggacagttgcactgaattgattcctgcagccaacatcttgtgcaggcacaattgagccatttttattttattcccttccgtaaacagaaatttcataaacggtctttgcattgaactgaatttttacctcaaaatgcaaaaggctgatcctcttaaaaaacaatttttttaaaggacttggcacgaaaggtttttattgaaatattttgctaatcagttaatcaatttacgttacctcttcatcccatgttaagcttgtcaagaagattaattccttctgggctttgatatatggcttagtgagtctccagatacggcaaaacaggattccgctgttttttctgtctggggccatatagacttgatcaatgaatttttggtgtaagacacccttccacaaacatgaattttcagaggtatggctgttcctttggttctgttttttta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]