GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 06:58:11, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_015824009            2490 bp    mRNA    linear   VRT 23-MAY-2019
DEFINITION  PREDICTED: Protobothrops mucrosquamatus protein argonaute-3
            (LOC107294752), mRNA.
ACCESSION   XM_015824009
VERSION     XM_015824009.2
DBLINK      BioProject: PRJNA313429
KEYWORDS    RefSeq.
SOURCE      Protobothrops mucrosquamatus
  ORGANISM  Protobothrops mucrosquamatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata;
            Toxicofera; Serpentes; Colubroidea; Viperidae; Crotalinae;
            Protobothrops.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_015388179.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On May 23, 2019 this sequence version replaced XM_015824009.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Protobothrops mucrosquamatus
                                           Annotation Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2490
                     /organism="Protobothrops mucrosquamatus"
                     /mol_type="mRNA"
                     /isolate="PMUCROS"
                     /db_xref="taxon:103944"
                     /chromosome="Unknown"
     gene            1..2490
                     /gene="LOC107294752"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 13 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:107294752"
     CDS             37..2412
                     /gene="LOC107294752"
                     /codon_start=1
                     /product="protein argonaute-3"
                     /protein_id="XP_015679495.1"
                     /db_xref="GeneID:107294752"
                     /translation="
MVQHFKVTIFGDRRPVYDGKRSLYTANPLPVATTGVDLDVTLPGEGGKDRPFKVSIKFVSRVSWHLLHEVLTGRTLPEPLELDKPISTNPVHAVDVVLRHLPSMKYTPVGRSFFSAPEGYDHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIQFMCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYDADPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQKPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"
     misc_feature    46..330
                     /gene="LOC107294752"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    358..510
                     /gene="LOC107294752"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    511..873
                     /gene="LOC107294752"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(667..669,712..714,754..756,766..768,820..822,
                     841..843,847..849)
                     /gene="LOC107294752"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1006..2283
                     /gene="LOC107294752"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1417..1419,1429..1431,1465..1476,1483..1485,
                     1507..1509,1516..1518,1528..1530,1540..1542)
                     /gene="LOC107294752"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1621..1623,1627..1629,1837..1839,2251..2253)
                     /gene="LOC107294752"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
ccgtatcttgaggtttcaagggaggtagtagattcaatggtgcagcattttaaagtgacaatatttggtgaccgtagaccagtttacgatggtaaaagaagcctttatacagccaatccactccctgtagcaacaactggggttgatttggatgtaacattgccaggagaaggtggcaaagaccgtcccttcaaggtgtccataaaattcgtttcccgggtaagctggcacctgttgcatgaagttctgactggacgaaccttacctgagcctctggaattggacaagccaatcagcactaaccctgttcatgctgttgatgtggtgctacgacatttaccctccatgaagtatacacctgtaggccgttcctttttttcggctcccgaaggctatgatcatccattgggaggtggcagggaagtttggtttggatttcatcagtctgttcgaccagcaatgtggaaaatgatgctaaatattgatgtttctgccactgccttctacaaagcacaacctgtaattcagttcatgtgtgaagttcttgatatccacaacattgatgaacagccacgacctctgactgattctcaccgtgtaaaattcaccaaagagataaagggtctgaaggttgaagtgactcattgtggaacgatgaggcggaaataccgcgtctgtaatgttacacggagacctgctagtcatcagacatttccattgcagttagaaaatggtcagacggtggagagaacagtagcacagtatttcagagaaaagtacaacctacagctgaagtatcctcatcttccttgtctacaagtgggacaggagcagaaacacacctatctgcctcttgaagtttgtaacatcgtggcaggccagcgatgtattaagaagcttacagacaatcaaacgtcaacaatgataaaagcaacagccaggtctgcacctgacagacaagaagaaatcagcagactggtgcgaagtgcaaattatgatgctgacccatttgttcaggaattccagtttaaagtgcgtgacgagatggctcatgtgacggggagagtgctcccagctccgatgttgcagtatggagggcggaatcgaacagtggcgacaccaagccatggtgtatgggatatgcgtgggaaacagtttcatacaggtgtggaaatcaagatgtgggccattgcttgctttgccacacagaggcagtgtcgcgaagaaatactaaagggttttacagatcagctgcgcaaaatctccaaggacgcggggatgccaatccagggccagccttgcttctgtaaatacgcacaaggtgctgacagtgtggagcccatgttccgacatctgaaaaacacatattcaggactccagctcatcatcgtcattctgccggggaagacaccggtctatgcggaggtgaaacgtgtgggggacacacttctggggatggctacacagtgtgttcaagtcaagaatgtcatcaaaacgtctcctcagaccctctcaaacttgtgcctaaagattaatgtaaaattgggaggaatcaacaacatccttgtacctcatcaacgaccttctgtgttccaacaaccagtgatcttcttgggagcagatgttactcatccacctgctggggatggaaagaagccttccattgctgctgttgtaggtagcatggatgcacatccaagcaggtactgtgccacggtgagagtccagaaaccccgccaggagatcatccaagacttggcctccatggttagagaacttctcatccaattctacaaatcaacgcgattcaaacccacacgaatcatcttctaccgcgacggagtttcagaaggacagtttcgacaggtgttgtattatgagctgctggcaattagagaggcttgtatcagcttggaaaaagactatcagcctggcataacatacatcgtggttcagaagaggcatcatacgaggctgttttgtgctgataggacagaaagggttggaagaagcggaaacatccctgctggaaccacagtagatacggatatcacacatccatacgaatttgatttttatctctgtagccatgcaggaatacagggtaccagccgcccctcacactatcatgtcttgtgggatgacaattgttttactgcagatgaacttcagctgctaacgtaccagctctgccacacctatgtgcgctgcacacgatctgtgtctatacctgcaccagcttattatgctcacctggtagcattcagagcaagataccaccttgtggacaaagaacatgacagtgccgaaggaagccatgtttccggacagagcaacggaagagatccccaagccctcgctaaggctgtacagattcaccaagacaccttacgcaccatgtactttgcttagctatatatacaatagaggtagagagaagagatctaaaaacgagatggagcctattcacgaaagagaaagaaagaaaga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]