2024-04-26 06:58:11, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_015824009 2490 bp mRNA linear VRT 23-MAY-2019 DEFINITION PREDICTED: Protobothrops mucrosquamatus protein argonaute-3 (LOC107294752), mRNA. ACCESSION XM_015824009 VERSION XM_015824009.2 DBLINK BioProject: PRJNA313429 KEYWORDS RefSeq. SOURCE Protobothrops mucrosquamatus ORGANISM Protobothrops mucrosquamatus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata; Toxicofera; Serpentes; Colubroidea; Viperidae; Crotalinae; Protobothrops. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_015388179.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On May 23, 2019 this sequence version replaced XM_015824009.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Protobothrops mucrosquamatus Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2490 /organism="Protobothrops mucrosquamatus" /mol_type="mRNA" /isolate="PMUCROS" /db_xref="taxon:103944" /chromosome="Unknown" gene 1..2490 /gene="LOC107294752" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 13 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:107294752" CDS 37..2412 /gene="LOC107294752" /codon_start=1 /product="protein argonaute-3" /protein_id="XP_015679495.1" /db_xref="GeneID:107294752" /translation="
MVQHFKVTIFGDRRPVYDGKRSLYTANPLPVATTGVDLDVTLPGEGGKDRPFKVSIKFVSRVSWHLLHEVLTGRTLPEPLELDKPISTNPVHAVDVVLRHLPSMKYTPVGRSFFSAPEGYDHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIQFMCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYDADPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQKPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"
misc_feature 46..330 /gene="LOC107294752" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 358..510 /gene="LOC107294752" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 511..873 /gene="LOC107294752" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(667..669,712..714,754..756,766..768,820..822, 841..843,847..849) /gene="LOC107294752" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1006..2283 /gene="LOC107294752" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1417..1419,1429..1431,1465..1476,1483..1485, 1507..1509,1516..1518,1528..1530,1540..1542) /gene="LOC107294752" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1621..1623,1627..1629,1837..1839,2251..2253) /gene="LOC107294752" /note="active site" /db_xref="CDD:240015" ORIGIN
ccgtatcttgaggtttcaagggaggtagtagattcaatggtgcagcattttaaagtgacaatatttggtgaccgtagaccagtttacgatggtaaaagaagcctttatacagccaatccactccctgtagcaacaactggggttgatttggatgtaacattgccaggagaaggtggcaaagaccgtcccttcaaggtgtccataaaattcgtttcccgggtaagctggcacctgttgcatgaagttctgactggacgaaccttacctgagcctctggaattggacaagccaatcagcactaaccctgttcatgctgttgatgtggtgctacgacatttaccctccatgaagtatacacctgtaggccgttcctttttttcggctcccgaaggctatgatcatccattgggaggtggcagggaagtttggtttggatttcatcagtctgttcgaccagcaatgtggaaaatgatgctaaatattgatgtttctgccactgccttctacaaagcacaacctgtaattcagttcatgtgtgaagttcttgatatccacaacattgatgaacagccacgacctctgactgattctcaccgtgtaaaattcaccaaagagataaagggtctgaaggttgaagtgactcattgtggaacgatgaggcggaaataccgcgtctgtaatgttacacggagacctgctagtcatcagacatttccattgcagttagaaaatggtcagacggtggagagaacagtagcacagtatttcagagaaaagtacaacctacagctgaagtatcctcatcttccttgtctacaagtgggacaggagcagaaacacacctatctgcctcttgaagtttgtaacatcgtggcaggccagcgatgtattaagaagcttacagacaatcaaacgtcaacaatgataaaagcaacagccaggtctgcacctgacagacaagaagaaatcagcagactggtgcgaagtgcaaattatgatgctgacccatttgttcaggaattccagtttaaagtgcgtgacgagatggctcatgtgacggggagagtgctcccagctccgatgttgcagtatggagggcggaatcgaacagtggcgacaccaagccatggtgtatgggatatgcgtgggaaacagtttcatacaggtgtggaaatcaagatgtgggccattgcttgctttgccacacagaggcagtgtcgcgaagaaatactaaagggttttacagatcagctgcgcaaaatctccaaggacgcggggatgccaatccagggccagccttgcttctgtaaatacgcacaaggtgctgacagtgtggagcccatgttccgacatctgaaaaacacatattcaggactccagctcatcatcgtcattctgccggggaagacaccggtctatgcggaggtgaaacgtgtgggggacacacttctggggatggctacacagtgtgttcaagtcaagaatgtcatcaaaacgtctcctcagaccctctcaaacttgtgcctaaagattaatgtaaaattgggaggaatcaacaacatccttgtacctcatcaacgaccttctgtgttccaacaaccagtgatcttcttgggagcagatgttactcatccacctgctggggatggaaagaagccttccattgctgctgttgtaggtagcatggatgcacatccaagcaggtactgtgccacggtgagagtccagaaaccccgccaggagatcatccaagacttggcctccatggttagagaacttctcatccaattctacaaatcaacgcgattcaaacccacacgaatcatcttctaccgcgacggagtttcagaaggacagtttcgacaggtgttgtattatgagctgctggcaattagagaggcttgtatcagcttggaaaaagactatcagcctggcataacatacatcgtggttcagaagaggcatcatacgaggctgttttgtgctgataggacagaaagggttggaagaagcggaaacatccctgctggaaccacagtagatacggatatcacacatccatacgaatttgatttttatctctgtagccatgcaggaatacagggtaccagccgcccctcacactatcatgtcttgtgggatgacaattgttttactgcagatgaacttcagctgctaacgtaccagctctgccacacctatgtgcgctgcacacgatctgtgtctatacctgcaccagcttattatgctcacctggtagcattcagagcaagataccaccttgtggacaaagaacatgacagtgccgaaggaagccatgtttccggacagagcaacggaagagatccccaagccctcgctaaggctgtacagattcaccaagacaccttacgcaccatgtactttgcttagctatatatacaatagaggtagagagaagagatctaaaaacgagatggagcctattcacgaaagagaaagaaagaaaga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]