GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-03-29 01:32:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_011763422            3095 bp    mRNA    linear   PRI 24-APR-2018
DEFINITION  PREDICTED: Macaca nemestrina argonaute 3, RISC catalytic component
            (AGO3), transcript variant X7, mRNA.
ACCESSION   XM_011763422
VERSION     XM_011763422.1
DBLINK      BioProject: PRJNA279145
KEYWORDS    RefSeq.
SOURCE      Macaca nemestrina (pig-tailed macaque)
  ORGANISM  Macaca nemestrina
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Cercopithecidae; Cercopithecinae; Macaca.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_012011688.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Macaca nemestrina Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3095
                     /organism="Macaca nemestrina"
                     /mol_type="mRNA"
                     /isolate="M95218"
                     /db_xref="taxon:9545"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="blood"
     gene            1..3095
                     /gene="AGO3"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 37 ESTs, 10 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 10 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:105494707"
     CDS             378..2258
                     /gene="AGO3"
                     /codon_start=1
                     /product="protein argonaute-3 isoform X3"
                     /protein_id="XP_011761724.1"
                     /db_xref="GeneID:105494707"
                     /translation="
MCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYTLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYETDPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"
     misc_feature    378..719
                     /gene="AGO3"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(513..515,558..560,600..602,612..614,666..668,
                     687..689,693..695)
                     /gene="AGO3"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    852..2129
                     /gene="AGO3"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1263..1265,1275..1277,1311..1322,1329..1331,
                     1353..1355,1362..1364,1374..1376,1386..1388)
                     /gene="AGO3"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1467..1469,1473..1475,1683..1685,2097..2099)
                     /gene="AGO3"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
tgaagtgggattgctagatcatatagtagttctatttttaatgttttgaggaacctccatactgttttctgtaaaggctgcaacaagggtttattaattgccaataaaatgctgctgtgaaaaataatgagaaatattgcactgacgatgttacttggttacatttccttttttgcttttgcgtgattttgattttggaagccttgtacgtggtatactgcactgaactaaacagcctttattgaacttgaaatcagctggagaagactggtattgagcactatattagaaacgggaaatgtttctaaagtttatttggatggaagtttagcatttctgccactgccttctacaaagcacaacctgtaattcagttcatgtgtgaagttcttgatattcataatattgatgagcaaccaagacctctgactgattctcatcgggtaaaattcaccaaagagataaaaggtttgaaagttgaagtgactcattgtggaacaatgagacggaaataccgtgtttgtaatgtaacaaggaggcctgccagtcatcaaacctttcctttacagttagaaaatggccaaactgtggagagaacagtagcgcagtatttcagagaaaagtatactcttcagctgaagtacccgcaccttccctgcctgcaagtcgggcaggagcagaaacacacctacctgccgctagaagtctgtaatattgtggcagggcaacgatgtatcaagaagctaacagacaatcagacttccactatgatcaaggcaacagcaagatctgcaccagatagacaagaggaaattagcagattggtaagaagtgcaaattatgaaacggatccatttgttcaggagtttcaatttaaagttcgggatgaaatggctcatgtaactggacgcgtactgccagcacctatgctccagtatggaggacggaatcggacagtagcaacaccaagccacggagtatgggatatgcgagggaagcaattccacacaggagttgaaatcaaaatgtgggctatcgcttgttttgccacacagaggcagtgcagagaagaaatattgaagggtttcacagaccagctgcgtaagatttctaaggatgcagggatgcccatccagggccagccatgcttctgcaaatatgcacagggggcagacagcgtagagcccatgttccggcatctcaagaacacatattctggcctacagcttattatcgtcatcctgccagggaagacaccagtgtatgcggaagtgaaacgtgtaggagacacacttttgggtatggccacacaatgtgttcaagtcaagaatgtaataaaaacatctcctcaaactctctcaaacttgtgcctaaagataaatgttaaactcggaggaatcaataatattcttgtacctcatcaaagaccttctgtgttccagcaaccagtgatctttttgggagccgatgtcactcatccacctgctggtgatggaaagaagccttctattgctgctgttgtaggtagtatggatgcccacccaagcagatactgtgccacagtaagagttcagagaccccgacaggagatcatccaggacttggcctccatggtccgggaacttcttattcaattttataagtcaactcggttcaagcctactcgtatcatcttttatcgggatggtgtttcagaagggcagtttaggcaggtattatattatgaactactagcaattcgagaagcctgcatcagtttggagaaagactatcaacctggaataacctacattgtagttcagaagagacaccacactcgattattttgtgctgataggacagaaagggttggaagaagtggcaatatcccagctggaacaacagttgatacagacattacacacccatatgagtttgatttttacctctgtagccatgctggaatacagggtaccagtcgtccttcacactatcatgttttatgggatgataactgcttcactgcagatgaacttcagctgctaacttaccagctctgccatacttatgtacgctgtacacgatctgtttctatacctgcaccagcgtattacgctcacctggtagcatttagagccagatatcatcttgtggacaaagaacatgacagtgctgaaggaagtcacgtttcaggacagagcaatgggcgagatccacaagctcttgccaaggctgtacagattcaccaagataccttacgcacaatgtactttgcttaaatagtccaagtatattctctgagaggaagcactgaaagatgaattgacatacaacgtatgtttccagtggagtcaattgagtaaggacacctccagccatacagaaaccaacactgtgtgggggccaaggtctgatccttatgttaatacaaggaagattgtttacttcatcaaggaacacagcatcattatgcaatatgaaaccagccaactgctttttgtgcggtctcctgtaggaagtatcgcaattgttttgttttcatttcttgtagtctaacccttttaatgcctttacctcaagttgcttggcagcacaactatctttgcaaaaaaagtatcgaaaaagtaaatgatggtttaaaaaatatacaccttcatgaataatcaaagtgatttttcaaaattatgtgcaaaaaattaatgtgcattcatatattcttgtaaaaggtgtctgtgtgtttttaaaatatatacatccatacttcatatgcatatatatctggatctggattgataatagatatatatgtgtctgtgtatatattttagaattcattccatttggggaacttcctttcccttttattctactagcactaccgcttttatttctctttttcccttgccttcatcacctacattttttccctaatcctaccagtgacattcaaacattcacctacctggttcctttgaatgtaaaatatggcaaactagatttctacttttattttgcataccctattcctgactcctgtctcctacatgattctgagttctcaactcttgatattgctgtcttaagaatcaaacttttatatatatatagtatacata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]