2024-04-20 12:18:52, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_008650906 3884 bp mRNA linear PLN 31-AUG-2020 DEFINITION PREDICTED: Zea mays protein argonaute PNH1 (LOC103629795), transcript variant X2, mRNA. ACCESSION XM_008650906 VERSION XM_008650906.4 DBLINK BioProject: PRJNA655717 KEYWORDS RefSeq. SOURCE Zea mays ORGANISM Zea mays Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae; Zea. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_050101.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Aug 31, 2020 this sequence version replaced XM_008650906.3. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Zea mays Annotation Release 103 Annotation Version :: 103 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3884 /organism="Zea mays" /mol_type="mRNA" /cultivar="B73" /db_xref="taxon:4577" /chromosome="6" gene 1..3884 /gene="LOC103629795" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 ESTs, 86 long SRA reads, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 13 samples with support for all annotated introns" /db_xref="GeneID:103629795" CDS 651..3518 /gene="LOC103629795" /codon_start=1 /product="protein argonaute PNH1 isoform X2" /protein_id="XP_008649128.1" /db_xref="GeneID:103629795" /translation="
MLEVVLDMTPPPPPPQARLHQGSSAKGGHAERRKQPLQSSVTQPKAEPAAAAAVLPVPEGGKRCRGGGRRRGRAKAPGEPRAALLAPAQAQTQAPPPRTVIGPPVPSKGLSFCRRPGFGTVGARCVVKANHFLAELPDKDLTQYDVKITPEVSSRTVNRAIMAELVRLYRASDLGMRLPAYDGRKNLYTAGTLPFDAREFVVRLADEDDGSGVPPREREYRVAIKFAARADLHHLRQFIAGRQADAPQEALQVLDIVLRELANQRYVSIGRSFYSPDIRKPQRLGDGLQSWRGFYQSIRPTQMGLSLNIDMSSTAFIEPLPVIEFVAQILGKDVISRPLSDANRIKIKKALRGVKVEVTHRGNVRRKYRISGLTTQPTHELIFPIDEQMNMKSVVEYFKEMYGFTIQHPHLPCLQVGNQKKANYLPMEACKIIEGQRYTKRLNEKQITSLLKVTCQRPREQEMDILQTVHQNDYEQDPYAKEFGINISEKLTSVEARVLPAPWLKYHDTGKEKECLPQVGQWNMVNKKVINGCKVSHWACINFSRSVPETTARGFCQELAQMCQISGMEFNSEPVMPIYSARPDQVVKALKNVYNIALNKLKGKDLELLLAILPDNNGQLYGDIKRICETDLGLISQCCLTKHVFKISKQYLANVSLKINVKMGGRNTVLLDAISWRIPLVSDIPTIIFGADVTHPETGEDSSPSIAAVVASQDWPEVTKYAGLVCAQAHRQELIQDLYKTWHDPQRGTVTGGMIRELLISFRKATGQKPLRIIFYRDGVSEGQFYQVLLYELDAIRKACASLEPNYQPPVTFVVVQKRHHTRLFANNHKDRSSMDKSGNILPGTVVDSKICHPTEFDFYLCSHAGIQGTSRPAHYHVLWDENNFTADEMQTLTNNLCYTLMYTDAVMPGAHARFLLSLLHTTHTWQHSGLGSTWNQRCWTTRRPRPPMARAESR"
misc_feature 930..3347 /gene="LOC103629795" /note="protein argonaute; Provisional; Region: PLN03202" /db_xref="CDD:215631" ORIGIN
cgtgccccggctcgttttccacggcttttttacgggccgcgccatcaccatgcatggcttgcctgccgctgccgcccgcgctagtggacctccagcacaatccccggttctccgacgcctgccacctttgttggtaaaaaacagtgaggacgtcgctgccgcttccgtcatgactgttcaccagactatgaccgttcacagactaccctacccctccccctccctcggccggtcccgttcccgcgccgcccgccggccgcccagtccctagcatagcaggccaaacctgcctccgcgcagttgctgccgcgtcaatgctgccgtgccgctggagagagagagagagaggttcttctaatgcccttctgttctgtcccgcccccgcgccgcatttttttttcatttttttttaccttgcgtgacgcttcgttttcacagtgcggcggcggcggctgcttggctcgttgctcctcccattctgctcagctcagcttctgatgagttcgcctttgccgctgctagttaccagcatactagaccactgactgatcacgttataaggcttccgcgcaggcgagcttctgccgccttgtcgggtaaccaaacggacctcgccggccctctccagtggtcacatcacatcacatcacatgctcgaggtcgtcctggacatgacgccgccgccgccgccgccgcaggcgcggctccaccaggggtcatcagccaagggcgggcacgcggagcggaggaagcaaccgctgcagagcagcgtgacacagcccaaggcagagcccgcggcggcggcggccgtgctgccggtgccggagggaggcaagaggtgcagagggggcgggaggcgccgcggcagggccaaggcgcccggtgagcctcgcgccgcgctactagcgccagcgcaggcgcagacgcaggcgcctccgccgcgcacggtcattgggccgcccgtgccgagcaaggggctgtcattctgccgccggccagggttcgggacggtgggcgcgcgctgcgtcgtcaaggccaaccacttcctcgccgagctcccggacaaggacctcacccagtacgatgtgaagatcacgccggaggtgagctcgcggaccgtgaaccgggccataatggcggagctggtccgcctctaccgcgcgtccgacctggggatgcgactcccggcctacgacggccgcaagaacctctacaccgccgggacactaccgttcgacgctcgcgagttcgtcgtgcgcctcgccgatgaggacgacggctccggcgtcccgcctcgggagagggagtacagggtcgccatcaagttcgccgcgcgcgccgacctccaccacctcaggcagttcatcgccgggcggcaggcggacgcgccgcaggaggccctacaggtactcgacatcgtgctccgcgagctcgccaaccagaggtacgtgtccatagggcggtccttctactcgccggacatcaggaagccgcagcggctcggcgacggcctgcagtcgtggcgtgggttctaccagagcatccggccgacccagatgggattgtcgcttaacatcgacatgtcgtccacggcatttattgaacccctgccggtgatcgagttcgtggcccagatattaggaaaggatgtcatatcaaggccattgtccgatgctaaccgaatcaagatcaagaaggcattgcggggtgtaaaagttgaggtcactcaccgggggaatgtacggcgcaagtatcgcatttcaggcctcacaacacagccaactcatgaattgattttcccgattgatgaacaaatgaatatgaaatctgtcgtggaatacttcaaggaaatgtatggtttcaccattcagcatcctcatcttccctgccttcaggttggaaaccaaaagaaggcaaactatctacccatggaggcctgcaagatcattgaaggccagagatacacaaagaggctgaatgaaaaacagatcacatcgctgctaaaggttacatgccaaaggcctagagagcaagagatggatattctacagacagttcatcaaaatgattatgagcaagatccatatgcgaaggaatttgggatcaacattagtgagaagctaacctctgttgaagcccgagtccttcctgcaccttggttgaagtatcatgacactggaaaagagaaagagtgcttaccacaggttggtcagtggaacatggtaaacaagaaagtgataaatggatgcaaggtgagccattgggcatgtataaacttctcaaggagtgttccagaaaccacagctcggggattttgccaggaattggcacaaatgtgtcaaatttcgggcatggaatttaacagtgagcctgtgatgccaatatattcagctagaccagatcaagttgtgaaggcacttaaaaacgtgtataatattgcattgaacaaacttaagggtaaagatcttgaacttcttttggctatcctccctgacaacaatgggcagttatatggtgacatcaaacgtatttgtgaaactgatttggggttgatatcacaatgttgcttaaccaagcatgtttttaagatcagcaagcagtacttggcaaatgtctcactgaaaattaatgttaagatgggaggaagaaacactgtgctcctggacgcaataagttggaggattccgttggtcagtgacatcccaactattatatttggtgcagatgtaacacatcctgaaaccggggaggactcaagtccatcgattgctgccgttgttgcttctcaagattggccagaagttacaaagtatgctggattggtttgtgctcaggcacaccggcaagagctcattcaagacctttacaaaacatggcacgatcctcagagaggcactgtaacaggcggcatgatcagggagctcttaatatccttcaggaaggccactggacagaagccattgagaataatattctacagggacggtgttagtgaaggtcagttctatcaagttctcctttacgagttagatgccatccggaaggcatgtgcatccctagaaccaaattaccagcctcctgtaacatttgtggtggttcaaaaacgtcatcatacaagactatttgcaaataatcacaaagacagaagtagcatggacaagagtggaaatattttgccaggaaccgttgttgattctaagatatgccacccaacggagtttgatttctacctctgtagtcatgctggaatccagggaacgagtaggcctgctcactaccatgtcctctgggatgagaacaatttcacagcagacgaaatgcagacattgacaaacaacctttgctacacattgatgtatactgatgcagttatgcccggtgcacacgctcggtttctgttgtccctcctgcatactacgcacacttggcagcattccgggctcggttctacatggaaccagagatgttggacaaccagacgtccaagacctccaatggcacgagcggagtctcggtgaagcccctgcctgctgtgaaggagaaggtgaaaaggatgatgttctactgctgacaaggagaccacttaaccactcacatgctgtagctaacttgctagagtttagtaaggattagatagctttctcaaggagtgatggatcaatctgatctgttaacgacctctgtaaagtactcggaaatggctgtataatagttgttgtttcaaatgtgaaagcatctaggtccttagttagatttcagtgatcagtgatcaatgacgatactagattattgtgactaatgtatgctagattattatgattaatgtatgttttgcagaaacaatggattttgtgccgccattaatagtattcaattttggtttt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]