GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-25 14:35:53, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_001878345            2352 bp    mRNA    linear   PLN 13-NOV-2023
DEFINITION  Laccaria bicolor S238N-H82 argonaute-like protein (AGO16204),
            partial mRNA.
ACCESSION   XM_001878345
VERSION     XM_001878345.1
DBLINK      BioProject: PRJNA29019
            BioSample: SAMN02769624
KEYWORDS    RefSeq.
SOURCE      Laccaria bicolor S238N-H82
  ORGANISM  Laccaria bicolor S238N-H82
            Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
            Agaricomycetes; Agaricomycetidae; Agaricales; Agaricineae;
            Hydnangiaceae; Laccaria.
REFERENCE   1  (bases 1 to 2352)
  AUTHORS   Martin,F., Aerts,A., Ahren,D., Brun,A., Danchin,E.G.,
            Duchaussoy,F., Gibon,J., Kohler,A., Lindquist,E., Pereda,V.,
            Salamov,A., Shapiro,H.J., Wuyts,J., Blaudez,D., Buee,M.,
            Brokstein,P., Canback,B., Cohen,D., Courty,P.E., Coutinho,P.M.,
            Delaruelle,C., Detter,J.C., Deveau,A., DiFazio,S., Duplessis,S.,
            Fraissinet-Tachet,L., Lucic,E., Frey-Klett,P., Fourrey,C.,
            Feussner,I., Gay,G., Grimwood,J., Hoegger,P.J., Jain,P., Kilaru,S.,
            Labbe,J., Lin,Y.C., Legue,V., Le Tacon,F., Marmeisse,R.,
            Melayah,D., Montanini,B., Muratet,M., Nehls,U., Niculita-Hirzel,H.,
            Oudot-Le Secq,M.P., Peter,M., Quesneville,H., Rajashekar,B.,
            Reich,M., Rouhier,N., Schmutz,J., Yin,T., Chalot,M., Henrissat,B.,
            Kues,U., Lucas,S., Van de Peer,Y., Podila,G.K., Polle,A.,
            Pukkila,P.J., Richardson,P.M., Rouze,P., Sanders,I.R.,
            Stajich,J.E., Tunlid,A., Tuskan,G. and Grigoriev,I.V.
  TITLE     The genome of Laccaria bicolor provides insights into mycorrhizal
            symbiosis
  JOURNAL   Nature 452 (7183), 88-92 (2008)
   PUBMED   18322534
REFERENCE   2  (bases 1 to 2352)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (12-NOV-2023) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 2352)
  AUTHORS   Zhou,K., Detter,J.C., Glavina del Rio,T., Dahlen,E., Tice,H.,
            Pitluck,S., Aerts,A., Salamov,A., Shapiro,H.J., Lindquist,E.,
            Lucas,S., Richardson,P.M., Ahren,D., Blaudez,D., Brun,A., Buee,M.,
            Chalot,M., Courty,P., Coutinho,P.M., Deveau,A., Duplessis,S.,
            Duchaussoy,F., Fourrey,C., Fraissinet-Tachet,L., Henrissat,B.,
            Gay,G., Gibon,J., Hoegger,P., Kohler,A., Kues,U., Labbe,J.,
            Muratet,M., Marmeisse,R., Melayah,D., Montanini,B., Napoli,C.,
            Podila,G., Reich,M., Rouhier,N., Rouze,P., Wuyts,J., Martin,F. and
            Grigoriev,I.V.
  CONSRTM   US DOE Joint Genome Institute (JGI-PGF)
  TITLE     Direct Submission
  JOURNAL   Submitted (19-NOV-2007) US DOE Joint Genome Institute, 2800
            Mitchell Drive B100, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_001889877).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..2352
                     /organism="Laccaria bicolor S238N-H82"
                     /mol_type="mRNA"
                     /strain="S238N-H82"
                     /db_xref="taxon:486041"
                     /chromosome="Unknown"
     gene            <1..>2352
                     /gene="AGO16204"
                     /locus_tag="LACBIDRAFT_315429"
                     /db_xref="GeneID:6074035"
     CDS             1..2352
                     /gene="AGO16204"
                     /locus_tag="LACBIDRAFT_315429"
                     /note="A PIWI/PAZ domain containing member of the
                     Argonaute gene family"
                     /codon_start=1
                     /product="argonaute-like protein"
                     /protein_id="XP_001878380.1"
                     /db_xref="GeneID:6074035"
                     /db_xref="InterPro:IPR003100"
                     /db_xref="InterPro:IPR003165"
                     /translation="
MQFHVSLPQANGGHNPTKPPKVYKIKLTLVADINPEVLERFVNGQQSNDNTVLTAIMALNNVIRQEPNLNYPFNVRSFFTDREKRDIGGGIELWRGYSQSVRPSIGRLLVNVDIATGMMYKEGPLLNLCMDFLRDRGLRSNSPDALAPPGFPDSERIRLQRFITGMRVIVETTGNRKRVIRGLSKAGANQLSFTLRDGTVMTVAQYFQQQLGRPLRYPGAVCVEVGASALIPLEVCKVPKGQIMRKQIPPSKTKDLVEFSTKRPEERLRSIMEGVDMLQYGQSQYIRDFGMTITTNTGPLEVSARVLKPLSLKYGEGSKQAVVTPKGGAWNMVDKRFYAPAAIKAWVILIYESERRFSSRDCQDMIKGFLHACDDVGIKVEVRDPIVKYENGQGNIATHFDNIGKQCVAKTKFLPTLIVAVLPDNVGDLYSTIKHHGDIRFGVATQCLKSHKCSRAKEQYWKNVMLKVNVKLGGINVVPSSTELSDPANPTIVIGTPSAIIASILTFCLSGADTAHPAPGAHDRPSFTSVVANVDSNVAKYVASTRVQKGRQEIITDLKEMCKDVLKLYGNYQEKMEKKAPNACKPKRLIFYRDGVSEGQFGHVLSQELPLIQEACRELGMSPKITLIVVGKRHHIRLFPQEQADRSGNCPAGTVADRGIAHPTEFDFYLQSHGGLLGTSRPAHYSVLHDENNFNSNTLQAFSFALCHVYARATRSVSIPAPVYYADIVCARAKNHYDPEGNLDLSESATGTVDSDRRDATLEAFKKGFKQVHQYHRMRMYFS"
     misc_feature    <46..189
                     /gene="AGO16204"
                     /locus_tag="LACBIDRAFT_315429"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    226..363
                     /gene="AGO16204"
                     /locus_tag="LACBIDRAFT_315429"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    364..714
                     /gene="AGO16204"
                     /locus_tag="LACBIDRAFT_315429"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(538..540,577..579,607..609,619..621,673..675,
                     685..687,691..693)
                     /gene="AGO16204"
                     /locus_tag="LACBIDRAFT_315429"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    850..2211
                     /gene="AGO16204"
                     /locus_tag="LACBIDRAFT_315429"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1288..1290,1300..1302,1336..1347,1351..1353,
                     1378..1380,1387..1389,1399..1401,1411..1413)
                     /gene="AGO16204"
                     /locus_tag="LACBIDRAFT_315429"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1537..1539,1543..1545,1780..1782,2179..2181)
                     /gene="AGO16204"
                     /locus_tag="LACBIDRAFT_315429"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
atgcagtttcacgtgagccttcctcaggcgaacggaggccacaacccgacgaagccaccaaaggtctacaagatcaagcttacgcttgtcgcagacatcaatcccgaggtccttgagcgattcgtcaatggtcaacagtccaacgataataccgttctcactgccatcatggctttgaacaatgtgatacgtcaagaacccaacctcaactatcctttcaacgttcgatcctttttcacagatcgggaaaagcgggatattggcggtggcattgagctctggcgcggatactcccaatccgtccgcccttctatcggacgcttgctggttaacgttgacattgcgacgggtatgatgtataaggagggtcctttgctcaacttatgcatggacttcttgagggatcgcggccttcggagtaattctccggacgcgcttgcacctcctggatttcccgatagtgaacgtattcgccttcagcgattcattaccggaatgcgcgtcatcgttgaaacaacggggaataggaagcgggttattaggggactctccaaggccggtgctaatcagctcagttttactctgcgcgacggcactgtcatgacggttgcccagtacttccagcagcaacttgggagacctttgaggtaccctggagccgtttgcgtcgaggttggtgcaagcgccctcattccacttgaggtctgcaaggtcccgaaaggccagataatgcgcaagcagattcccccttcaaaaaccaaggacctcgtcgaattttcgactaagcgacctgaagagcgccttagaagtatcatggagggcgtagatatgcttcaatacggtcaatctcaatacatccgcgacttcgggatgacgattaccacaaacacggggcctcttgaagtttctgccagggtcttgaaaccactcagcttgaagtacggcgaaggaagcaaacaggccgtagtgactccgaaaggtggggcctggaacatggttgacaaacggttctatgcgccagcagccatcaaggcgtgggttatcctcatctatgaatcggaaaggcggttttcgtctagagactgccaagacatgatcaaaggctttcttcatgcttgtgacgacgttggcattaaagtggaagtgcgcgatccaattgtcaagtatgagaatgggcagggcaacattgcaacgcattttgacaatattggcaaacaatgtgttgccaagacaaaatttctcccaacactgatcgtcgcggtgctaccagacaacgtgggtgacctttatagcaccattaaacaccacggtgacatcaggtttggcgttgcgacgcagtgcctcaagagccataaatgctcccgcgccaaagaacagtattggaaaaacgtcatgcttaaagtgaatgtcaaactgggcggaataaatgttgtaccatcatccaccgagctcagtgatccagccaacccaaccatcgtcataggtacgcccagcgcaatcatcgcaagcatattaacattctgtctctcaggcgctgataccgctcatccggcgcctggtgcacatgaccgcccatcgtttacatccgtcgtcgctaacgttgattcaaacgtcgcaaaatatgtcgctagtactcgagttcagaagggccgccaggagataattactgatctcaaagagatgtgcaaggatgtactgaagttgtacgggaattatcaagagaagatggaaaagaaggccccgaacgcctgcaagcccaagcggcttatcttctatcgagatggcgtttccgagggccaatttgggcatgttctttcgcaagagcttcctttaatccaagaagcctgccgggaactgggaatgtcccccaagataacattgatcgttgtggggaagcgtcatcacattcgtttatttccacaagaacaagcggatcgaagtggtaactgcccggcgggaaccgtcgctgaccgaggcatcgcccacccaacggaatttgatttttatctccaaagccatggaggccttctcggcaccagtcgtcctgcccactattctgtacttcatgatgaaaataacttcaattccaatactctccaagccttttcgtttgcactttgccatgtctacgcacgcgccacgcgttctgtttccattcctgctccagtgtattatgctgacatcgtctgcgcacgggcgaagaaccactacgatcccgaagggaaccttgacttatccgagtcggcaacagggacggtcgactccgaccgccgcgatgcaaccctcgaagcattcaagaaaggcttcaagcaggttcatcaatatcaccgaatgcgaatgtatttttcttga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]