ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-01-17 19:50:12, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NR_132173 443 bp RNA linear PLN 30-JUN-2025
DEFINITION Saccharomyces cerevisiae S288C RUF20 (RUF20), ncRNA.
ACCESSION NR_132173
VERSION NR_132173.1
DBLINK BioProject: PRJNA128
KEYWORDS RefSeq.
SOURCE Saccharomyces cerevisiae S288C
ORGANISM Saccharomyces cerevisiae S288C
Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
Saccharomyces.
REFERENCE 1 (bases 1 to 443)
AUTHORS Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M.,
Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S.,
Weng,S. and Cherry,J.M.
TITLE New data and collaborations at the Saccharomyces Genome Database:
updated reference genome, alleles, and the Alliance of Genome
Resources
JOURNAL Genetics 220 (4) (2022)
PUBMED 34897464
REFERENCE 2 (bases 1 to 443)
AUTHORS Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
Oliver,S.G.
TITLE Life with 6000 genes
JOURNAL Science 274 (5287), 546 (1996)
PUBMED 8849441
REFERENCE 3 (bases 1 to 443)
AUTHORS Murakami,Y., Naitou,M., Hagiwara,H., Shibata,T., Ozawa,M.,
Sasanuma,S., Sasanuma,M., Tsuchiya,Y., Soeda,E., Yokoyama,K. et al.
TITLE Analysis of the nucleotide sequence of chromosome VI from
Saccharomyces cerevisiae
JOURNAL Nat. Genet. 10 (3), 261-268 (1995)
PUBMED 7670463
REFERENCE 4 (bases 1 to 443)
CONSRTM NCBI Genome Project
TITLE Direct Submission
JOURNAL Submitted (30-JUN-2025) National Center for Biotechnology
Information, NIH, Bethesda, MD 20894, USA
REFERENCE 5 (bases 1 to 443)
CONSRTM Saccharomyces Genome Database
TITLE Direct Submission
JOURNAL Submitted (16-JAN-2015) Department of Genetics, Stanford
University, Stanford, CA 94305-5120, USA
REMARK Protein update by submitter
REFERENCE 6 (bases 1 to 443)
CONSRTM Saccharomyces Genome Database
TITLE Direct Submission
JOURNAL Submitted (04-MAY-2012) Department of Genetics, Stanford
University, Stanford, CA 94305-5120, USA
REMARK Protein update by submitter
REFERENCE 7 (bases 1 to 443)
CONSRTM Saccharomyces Genome Database
TITLE Direct Submission
JOURNAL Submitted (31-MAR-2011) Department of Genetics, Stanford
University, Stanford, CA 94305-5120, USA
REMARK Sequence update by submitter
REFERENCE 8 (bases 1 to 443)
CONSRTM Saccharomyces Genome Database
TITLE Direct Submission
JOURNAL Submitted (11-DEC-2009) Department of Genetics, Stanford
University, Stanford, CA 94305-5120, USA
COMMENT REVIEWED REFSEQ: This record has been curated by SGD. This record
is derived from an annotated genomic sequence (NC_001138).
##Genome-Annotation-Data-START##
Annotation Provider :: SGD
Annotation Status :: Full Annotation
Annotation Version :: R64-4-1
URL :: http://www.yeastgenome.org/
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..443
/organism="Saccharomyces cerevisiae S288C"
/mol_type="transcribed RNA"
/strain="S288C"
/db_xref="taxon:559292"
/chromosome="VI"
gene 1..443
/gene="RUF20"
/locus_tag="YNCF0003C"
/db_xref="GeneID:9164889"
ncRNA 1..443
/ncRNA_class="other"
/gene="RUF20"
/locus_tag="YNCF0003C"
/product="RUF20"
/experiment="EXISTENCE:direct assay:GO:0003729 mRNA
binding [PMID:29529031]"
/experiment="EXISTENCE:direct assay:GO:0008298
intracellular mRNA localization [PMID:29529031]"
/note="Essential ncRNA; overlaps by 140 base pairs with
the 3' untranslated region (UTR) of the essential gene
SEC4, a GTPase required for vesicle-mediated exocytic
secretion and autophagy; in vivo there is dsRNA formation
between SUT527 and the SEC4 3' UTR; physical interaction
between SUT527 and the 3' UTR of SEC4 influences SEC4 3'
end formation and mRNA localization"
/db_xref="GeneID:9164889"
/db_xref="SGD:S000130127"
ORIGIN
acgtgggtttttttttcgaattgagtgattatgcaaccatacaggaaccttacataagcgcaagtagttgaatagtggattcaagaagcaaaactttactaccggtaaaaacattagaacgaaataaaagtgctgaatcttaaaagtaaaatatatacttggataagaattcccagggaaactgggaacctcgttttcctgttgcactattttttagattctttcttgattttttaccaatcgcctgatgaaaataccttccagagcagagaacaacagtagaagtatgctgaaaaagttagtgtgagaagtttgaattgtttagataatataaaagtgacatctaatatgactaatataaaaatagtaagtatggtaatcaaaaaaagatacaaacaatgtatatatataaaggaaaaataacctgcgaatattgagaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]