GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-30 10:16:33, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_214258               1236 bp    mRNA    linear   MAM 22-DEC-2022
DEFINITION  Sus scrofa protein kinase cAMP-dependent type II regulatory subunit
            alpha (PRKAR2A), mRNA.
ACCESSION   NM_214258
VERSION     NM_214258.2
KEYWORDS    RefSeq.
SOURCE      Sus scrofa (pig)
  ORGANISM  Sus scrofa
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae;
            Sus.
REFERENCE   1  (bases 1 to 1236)
  AUTHORS   Nishimura T, Fujii W, Sugiura K and Naito K.
  TITLE     Cytoplasmic anchoring of cAMP-dependent protein kinase (PKA) by
            A-kinase anchor proteins (AKAPs) is required for meiotic arrest of
            porcine full-grown and growing oocytes
  JOURNAL   Biol Reprod 90 (3), 58 (2014)
   PUBMED   24501172
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1236)
  AUTHORS   Nishimura T, Sugiura K and Naito K.
  TITLE     A-kinase anchor protein 1 (AKAP1) regulates cAMP-dependent protein
            kinase (PKA) localization and is involved in meiotic maturation of
            porcine oocytes
  JOURNAL   Biol Reprod 88 (4), 85 (2013)
   PUBMED   23426434
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1236)
  AUTHORS   Nishimura T, Fujii W, Kano K, Sugiura K and Naito K.
  TITLE     Analyses of the involvement of PKA regulation mechanism in meiotic
            incompetence of porcine growing oocytes
  JOURNAL   Biol Reprod 87 (3), 53 (2012)
   PUBMED   22674394
  REMARK    GeneRIF: Analyses of the involvement of PKA regulation mechanism in
            meiotic incompetence of porcine growing oocytes.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1236)
  AUTHORS   Hemmings,B.A., Schwarz,M., Adavani,S.R. and Jans,D.A.
  TITLE     Expression cloning of a cDNA encoding the type II regulatory
            subunit of the cAMP-dependent protein kinase
  JOURNAL   FEBS Lett 209 (2), 219-222 (1986)
   PUBMED   2431926
REFERENCE   5  (bases 1 to 1236)
  AUTHORS   Potter,R.L. and Taylor,S.S.
  TITLE     Correlation of the cAMP binding domain with a site of
            autophosphorylation on the regulatory subunit of cAMP-dependent
            protein kinase II from porcine skeletal muscle
  JOURNAL   J Biol Chem 254 (18), 9000-9005 (1979)
   PUBMED   225318
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AB499528.1.
            
            On Jun 11, 2010 this sequence version replaced NM_214258.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB499528.1, SRR5275321.436620.1
                                           [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA103886111, SAMEA103886112
                                           [ECO:0000350]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1236
                     /organism="Sus scrofa"
                     /mol_type="mRNA"
                     /db_xref="taxon:9823"
                     /chromosome="13"
                     /map="13"
     gene            1..1236
                     /gene="PRKAR2A"
                     /note="protein kinase cAMP-dependent type II regulatory
                     subunit alpha"
                     /db_xref="GeneID:397493"
                     /db_xref="VGNC:VGNC:91804"
     exon            1..254
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     CDS             2..1207
                     /gene="PRKAR2A"
                     /EC_number="2.7.11.1"
                     /note="cAMP-dependent protein kinase, regulatory subunit
                     alpha 2"
                     /codon_start=1
                     /product="cAMP-dependent protein kinase type II-alpha
                     regulatory subunit"
                     /protein_id="NP_999423.2"
                     /db_xref="GeneID:397493"
                     /db_xref="VGNC:VGNC:91804"
                     /translation="
MSHIQIPPGLTELLQGYTVEVLRRQPPDLVDFAVDYFTRLREARSRASTPPAAPPSGSQDLEPSSGLVTDAIADSESEDDEDLDVPIPSRFDRRVSVCAETYNPDEEEEDTDPRVIHPKTDQQRCRLQEACKDILLFKNLDQEQLSQVLDAMFERTVKVDEHVIDQGDDGDNFYVIERGTYDILVTKDNQTRSVGQYDNHGSFGELALMYNTPRAATIVATSEGSLWGLDRVTFRRIIVKNNAKKRKMFESFIESVPLLKSLEVSERMKIVDVIGEKIYKDGERIITQGEKADSFYIIESGEVSILIKSKTKANKDGGNQEVEIARCHKGQYFGELALVTNKPRAASAYAVGDVKCLVMDVQAFERLLGPCMDIMKRNISHYEEQLVKMFGSSMDLIDPGQ"
     misc_feature    11..133
                     /gene="PRKAR2A"
                     /note="dimerization/docking (D/D) domain of the Type II
                     alpha Regulatory subunit of cAMP-dependent protein kinase;
                     Region: DD_RIIalpha_PKA; cd12103"
                     /db_xref="CDD:438524"
     misc_feature    order(11..25,29..31,38..43,50..55,62..67,74..76,83..94,
                     98..103,110..115,119..124)
                     /gene="PRKAR2A"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:438524"
     misc_feature    order(17..19,29..34,41..46,53..58,65..70)
                     /gene="PRKAR2A"
                     /note="AKAP interaction site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:438524"
     misc_feature    407..745
                     /gene="PRKAR2A"
                     /note="effector domain of the CAP family of transcription
                     factors; members include CAP (or cAMP receptor protein
                     (CRP)), which binds cAMP, FNR (fumarate and nitrate
                     reduction), which uses an iron-sulfur cluster to sense
                     oxygen) and CooA, a heme containing CO...; Region: CAP_ED;
                     cd00038"
                     /db_xref="CDD:237999"
     misc_feature    order(611..616,641..649)
                     /gene="PRKAR2A"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:237999"
     misc_feature    order(707..715,725..733)
                     /gene="PRKAR2A"
                     /note="flexible hinge region; other site"
                     /db_xref="CDD:237999"
     misc_feature    773..1138
                     /gene="PRKAR2A"
                     /note="effector domain of the CAP family of transcription
                     factors; members include CAP (or cAMP receptor protein
                     (CRP)), which binds cAMP, FNR (fumarate and nitrate
                     reduction), which uses an iron-sulfur cluster to sense
                     oxygen) and CooA, a heme containing CO...; Region: CAP_ED;
                     cd00038"
                     /db_xref="CDD:237999"
     misc_feature    order(1001..1006,1031..1039)
                     /gene="PRKAR2A"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:237999"
     misc_feature    order(1097..1105,1115..1123)
                     /gene="PRKAR2A"
                     /note="flexible hinge region; other site"
                     /db_xref="CDD:237999"
     exon            255..290
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            291..343
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            344..427
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            428..534
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            535..688
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            689..790
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            791..865
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            866..931
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            932..1073
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
     exon            1074..1236
                     /gene="PRKAR2A"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
catgagccacatccagatcccgcctgggctcacggagctgctgcagggctacaccgtggaggtgctgcggcggcagccacccgacctggtcgacttcgcggtggactacttcacccgcctgcgcgaggcccgctcccgagcctccaccccacccgccgcccctccttccggctcccaggatctagagcccagctctggccttgtcaccgacgcgatcgcggacagcgagtcggaggacgacgaggacttggacgttccaattcctagcagatttgatcggcgagtatcagtctgtgctgagacctataaccctgatgaggaagaggaagatactgatccaagggtgattcaccctaaaactgatcaacaaagatgcagacttcaagaagcttgcaaagatattcttcttttcaaaaatcttgatcaggaacaactttctcaagtcctcgatgctatgtttgaaaggacagtcaaagttgatgagcatgtcattgaccaaggagatgatggagacaacttttatgttattgaacggggaacctatgatattttagtaacaaaagataatcaaacccgctctgttggtcagtatgacaaccatggcagttttggagaactagctctgatgtacaacaccccgagagctgctaccattgtcgccacttcagaaggctccctttggggactggaccgtgtgacttttagaagaatcatagtgaaaaacaatgcaaaaaagaggaagatgtttgaatcatttattgaatctgtgccactccttaaatcactagaggtgtcagaacgaatgaagatcgtggatgtaataggagaaaagatctataaggatggagagcgcatcatcacacagggtgaaaaggctgatagcttttacattatagagtctggtgaagtgagcatcttgattaaaagcaagactaaagcaaacaaggatggtgggaaccaggaggtcgagattgcccgctgccacaaggggcagtactttggagagcttgcactggtcaccaacaaacccagagctgcttcagcttatgcagtgggagatgtcaaatgcttagttatggatgtacaagcatttgagaggcttctggggccctgcatggacatcatgaagaggaacatctcacactatgaggaacagctggtgaagatgtttggctccagcatggatctgatcgatcccgggcagtaggtgtgccacaccccagagccttctcagtg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]