GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-15 05:52:43, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_214026               1425 bp    mRNA    linear   MAM 23-JUN-2025
DEFINITION  Sus scrofa protein kinase cAMP-dependent type I regulatory subunit
            alpha (PRKAR1A), mRNA.
ACCESSION   NM_214026
VERSION     NM_214026.1
KEYWORDS    RefSeq.
SOURCE      Sus scrofa (pig)
  ORGANISM  Sus scrofa
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae;
            Sus.
REFERENCE   1  (bases 1 to 1425)
  AUTHORS   Nishimura,T., Fujii,W., Sugiura,K. and Naito,K.
  TITLE     Cytoplasmic anchoring of cAMP-dependent protein kinase (PKA) by
            A-kinase anchor proteins (AKAPs) is required for meiotic arrest of
            porcine full-grown and growing oocytes
  JOURNAL   Biol Reprod 90 (3), 58 (2014)
   PUBMED   24501172
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1425)
  AUTHORS   Nishimura,T., Fujii,W., Kano,K., Sugiura,K. and Naito,K.
  TITLE     Analyses of the involvement of PKA regulation mechanism in meiotic
            incompetence of porcine growing oocytes
  JOURNAL   Biol Reprod 87 (3), 53 (2012)
   PUBMED   22674394
  REMARK    GeneRIF: Analyses of the involvement of PKA regulation mechanism in
            meiotic incompetence of porcine growing oocytes.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1425)
  AUTHORS   Cabral,L.M., Wengert,M., da Ressurreicao,A.A., Feres-Elias,P.H.,
            Almeida,F.G., Vieyra,A., Caruso-Neves,C. and Einicker-Lamas,M.
  TITLE     Ceramide is a potent activator of plasma membrane Ca2+-ATPase from
            kidney-promixal tubule cells with protein kinase A as an
            intermediate
  JOURNAL   J Biol Chem 282 (34), 24599-24606 (2007)
   PUBMED   17606608
  REMARK    GeneRIF: ceramide activates plasma membrane Ca2+-ATPase from
            kidney-promixal tubule cells with protein kinase A as an
            intermediate
REFERENCE   4  (bases 1 to 1425)
  AUTHORS   Uenishi,H., Eguchi-Ogawa,T., Shinkai,H., Okumura,N., Suzuki,K.,
            Toki,D., Hamasima,N. and Awata,T.
  TITLE     PEDE (Pig EST Data Explorer) has been expanded into Pig Expression
            Data Explorer, including 10 147 porcine full-length cDNA sequences
  JOURNAL   Nucleic Acids Res 35 (Database issue), D650-D653 (2007)
   PUBMED   17145712
REFERENCE   5  (bases 1 to 1425)
  AUTHORS   Uenishi,H., Eguchi,T., Suzuki,K., Sawazaki,T., Toki,D., Shinkai,H.,
            Okumura,N., Hamasima,N. and Awata,T.
  TITLE     PEDE (Pig EST Data Explorer): construction of a database for ESTs
            derived from porcine full-length cDNA libraries
  JOURNAL   Nucleic Acids Res 32 (Database issue), D484-D488 (2004)
   PUBMED   14681463
REFERENCE   6  (bases 1 to 1425)
  AUTHORS   Mellink,C., Lahbib-Mansais,Y., Yerle,M. and Gellin,J.
  TITLE     Mapping of the regulatory type I alpha and catalytic beta subunits
            of cAMP-dependent protein kinase and interleukin 1 alpha and 1 beta
            in the pig
  JOURNAL   Mamm Genome 5 (5), 298-302 (1994)
   PUBMED   8075502
REFERENCE   7  (bases 1 to 1425)
  AUTHORS   Bubis,J., Vedvick,T.S. and Taylor,S.S.
  TITLE     Antiparallel alignment of the two protomers of the regulatory
            subunit dimer of cAMP-dependent protein kinase I
  JOURNAL   J Biol Chem 262 (31), 14961-14966 (1987)
   PUBMED   3667618
REFERENCE   8  (bases 1 to 1425)
  AUTHORS   Nowak,I., Seipel,K., Schwarz,M., Jans,D.A. and Hemmings,B.A.
  TITLE     Isolation of a cDNA and characterization of the 5' flanking region
            of the gene encoding the type I regulatory subunit of the
            cAMP-dependent protein kinase
  JOURNAL   Eur J Biochem 167 (1), 27-33 (1987)
   PUBMED   3040400
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from X05942.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: X05942.1, AK238988.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN02389762, SAMN02584787
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1425
                     /organism="Sus scrofa"
                     /mol_type="mRNA"
                     /db_xref="taxon:9823"
                     /chromosome="12"
                     /map="12"
     gene            1..1425
                     /gene="PRKAR1A"
                     /note="protein kinase cAMP-dependent type I regulatory
                     subunit alpha"
                     /db_xref="GeneID:397091"
                     /db_xref="RGD:14019906"
                     /db_xref="VGNC:VGNC:91802"
     CDS             81..1223
                     /gene="PRKAR1A"
                     /EC_number="2.7.11.1"
                     /note="cAMP-dependent protein kinase type I regulatory
                     subunit; protein kinase, cAMP-dependent, regulatory, type
                     I, alpha (tissue specific extinguisher 1)"
                     /codon_start=1
                     /product="cAMP-dependent protein kinase type I-alpha
                     regulatory subunit"
                     /protein_id="NP_999191.1"
                     /db_xref="GeneID:397091"
                     /db_xref="RGD:14019906"
                     /db_xref="VGNC:VGNC:91802"
                     /translation="
MASGSTASEEERSLRECELYVQKHNIQALLKDSIVQLCTARPERPMAFLREYFERLEKEEAKQIQNLQKASARADSREDEISPPPPNPVVKGRRRRGAISAEVYTEEDAASYVRKVIPKDYKTMAALAKAIEKNVLFSHLDDNERSDIFDAMFPVSFIAGETVIQQGDEGDNFYVIDQGEMDVYVNNEWATSVGEGGSFGELALIYGTPRAATVKAKTNVKLWGNDRDSYRRILMGSTLRKRKMYEEFLSKVSILESLDKWERLTVADALEPVQFEDGQKIVVQGEPGDEFFIILEGSAAVLQRRSENEEFVEVGRLGPSDYFGEIALLMNRPRAATVVARGPLKCVKLDRPRFERVLGPCSDILKRNIQQYNSFVSLSV"
     misc_feature    81..83
                     /gene="PRKAR1A"
                     /note="N-acetylmethionine.
                     /evidence=ECO:0000250|UniProtKB:P10644; propagated from
                     UniProtKB/Swiss-Prot (P07802.2); acetylation site"
     misc_feature    84..485
                     /gene="PRKAR1A"
                     /note="propagated from UniProtKB/Swiss-Prot (P07802.2);
                     Region: Dimerization and phosphorylation"
     misc_feature    84..86
                     /gene="PRKAR1A"
                     /note="N-acetylalanine, in cAMP-dependent protein kinase
                     type I-alpha regulatory subunit, N-terminally processed.
                     /evidence=ECO:0000250|UniProtKB:P00514; propagated from
                     UniProtKB/Swiss-Prot (P07802.2); acetylation site"
     misc_feature    87..89
                     /gene="PRKAR1A"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P09456; propagated from
                     UniProtKB/Swiss-Prot (P07802.2); phosphorylation site"
     misc_feature    117..266
                     /gene="PRKAR1A"
                     /note="dimerization/docking (D/D) domain of the Type I
                     alpha Regulatory subunit of cAMP-dependent protein kinase;
                     Region: DD_RIalpha_PKA; cd12101"
                     /db_xref="CDD:438522"
     misc_feature    order(120..122,129..134,159..164,168..173,180..185)
                     /gene="PRKAR1A"
                     /note="AKAP interaction site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:438522"
     misc_feature    order(129..131,138..143,156..158,165..170,177..182,
                     189..194,204..206,210..221,225..230,237..242,249..251)
                     /gene="PRKAR1A"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:438522"
     misc_feature    270..368
                     /gene="PRKAR1A"
                     /note="propagated from UniProtKB/Swiss-Prot (P07802.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    306..308
                     /gene="PRKAR1A"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P10644; propagated from
                     UniProtKB/Swiss-Prot (P07802.2); phosphorylation site"
     misc_feature    324..326
                     /gene="PRKAR1A"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P10644; propagated from
                     UniProtKB/Swiss-Prot (P07802.2); phosphorylation site"
     misc_feature    363..377
                     /gene="PRKAR1A"
                     /note="propagated from UniProtKB/Swiss-Prot (P07802.2);
                     Region: Pseudophosphorylation motif"
     misc_feature    378..380
                     /gene="PRKAR1A"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9DBC7; propagated from
                     UniProtKB/Swiss-Prot (P07802.2); phosphorylation site"
     misc_feature    486..815
                     /gene="PRKAR1A"
                     /note="effector domain of the CAP family of transcription
                     factors; members include CAP (or cAMP receptor protein
                     (CRP)), which binds cAMP, FNR (fumarate and nitrate
                     reduction), which uses an iron-sulfur cluster to sense
                     oxygen) and CooA, a heme containing CO...; Region: CAP_ED;
                     cd00038"
                     /db_xref="CDD:237999"
     misc_feature    order(678..683,708..716)
                     /gene="PRKAR1A"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:237999"
     misc_feature    order(774..782,792..800)
                     /gene="PRKAR1A"
                     /note="flexible hinge region; other site"
                     /db_xref="CDD:237999"
     misc_feature    840..1187
                     /gene="PRKAR1A"
                     /note="effector domain of the CAP family of transcription
                     factors; members include CAP (or cAMP receptor protein
                     (CRP)), which binds cAMP, FNR (fumarate and nitrate
                     reduction), which uses an iron-sulfur cluster to sense
                     oxygen) and CooA, a heme containing CO...; Region: CAP_ED;
                     cd00038"
                     /db_xref="CDD:237999"
     misc_feature    849..851
                     /gene="PRKAR1A"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P09456; propagated from
                     UniProtKB/Swiss-Prot (P07802.2); phosphorylation site"
     misc_feature    order(1050..1055,1080..1088)
                     /gene="PRKAR1A"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:237999"
     misc_feature    order(1146..1154,1164..1172)
                     /gene="PRKAR1A"
                     /note="flexible hinge region; other site"
                     /db_xref="CDD:237999"
ORIGIN      
gaattccgctgagggagctcagcaagccgtcacctcacaccggtaatcccgtgcccgccgccgtctgtccccagggaaccatggcgtctggcagcaccgccagtgaggaggagcgtagcctccgggaatgtgagctctacgtccagaagcacaacattcaggccctgctcaaggattctatcgtgcagttgtgcactgcgcggcccgagagacccatggcattcctcagggaatacttcgagaggttggagaaggaggaggcaaagcagatccagaatctgcagaaagcaagtgcccgggcagactcgagggaggatgaaatctctcctcctccacccaacccagtggtaaagggccgaaggcgacgaggtgctatcagtgctgaggtctatacggaggaagatgctgcatcatatgttagaaaggttataccaaaagattataagacaatggctgctttagctaaagccattgaaaagaatgtactgttttcacatcttgatgataatgagagaagtgatatttttgatgccatgtttccggtttcctttattgctggagagactgttattcagcaaggtgatgaaggggataacttctatgtgattgatcaaggagagatggatgtctatgtcaacaatgagtgggcaaccagtgttggggaaggaggaagctttggagaacttgctctgatttatggtacacctagagcagccactgtcaaggcaaagacaaatgtgaaattgtggggtaatgaccgagacagctacagaagaatccttatgggaagcacgctgagaaagcggaagatgtatgaggagtttcttagtaaagtgtctattttagaatctctggacaagtgggaacgtcttactgttgctgatgcgttggaaccagtccagtttgaagatggacagaagattgtggtgcagggagaaccaggggacgagttcttcattattttagagggttcggctgctgtactacagcgtcgttcagaaaacgaagagtttgttgaagtgggaagattggggccttctgattattttggcgaaatcgcactactgatgaatcgtcctcgcgctgccactgtggttgctcgtggcccgttgaagtgcgttaagctggaccgacctagatttgaacgtgttcttggcccgtgctcagatatcctcaaacgaaacatccagcagtacaacagttttgtgtcactgtctgtctgaaatatgcctcctgtgcctctctcttcttttctccccagtcttcactcatgcagactgctttctggtccctctttgcagcaccacgtggccactggcatcgcagcttcttgtcagtttatattaaaagttgcttttattgcaccgttttattttggagcattaactgagtgctcatacacagttaaataaatagaaagaattc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]