2025-03-13 12:58:27, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_009291199 1610 bp mRNA linear VRT 08-SEP-2024 DEFINITION PREDICTED: Danio rerio vimentin-related 2 (vimr2), mRNA. ACCESSION XM_009291199 VERSION XM_009291199.4 DBLINK BioProject: PRJNA13922 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_007125.7) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Sep 8, 2024 this sequence version replaced XM_009291199.3. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_000002035.6-RS_2024_08 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 08/15/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1610 /organism="Danio rerio" /mol_type="mRNA" /strain="Tuebingen" /db_xref="taxon:7955" /chromosome="14" gene 1..1610 /gene="vimr2" /note="vimentin-related 2; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 ESTs, 2 long SRA reads, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 114 samples with support for all annotated introns" /db_xref="GeneID:798092" /db_xref="ZFIN:ZDB-GENE-160113-76" misc_feature 1 /gene="vimr2" /experiment="COORDINATES: cap analysis [ECO:0007248]" /note="transcription start site" CDS 29..1201 /gene="vimr2" /codon_start=1 /product="vimentin" /protein_id="XP_009289474.1" /db_xref="GeneID:798092" /db_xref="ZFIN:ZDB-GENE-160113-76" /translation="
MALLRVSSYRKLFEEEQTSLAAGRCGVQARFTARGGVSEIECPELDFAAARALNKEGASRFVHERSVIAALNDRLAGLIDVVRGLEEENESLEAEIIELKEKKESEQISTTTVSIRDPADFSLDAVIERLRKEKEEILCNTEELKGELRCLQMKCDQVVEHRTLIQQEREDVSVEVDAITTDCLALREQVGIYEEQLAAMERQHEMRLENLCEPGPLDEGFSTVSLQFPPFDITPAIMDIKGYYRTLAENLKFEFKGSHAAAVDAAGKEKKEEQLARLTGGKVKDISKETDVNVLKDLSAELEKELAELKKHGDELESEVKARKAKNLEEIEELENYISQLDEEEADLQFQIKDQSEDYEELLNQKMNLDIEIAAYRGLVEEEEERLSCL"
misc_feature 218..1186 /gene="vimr2" /note="Intermediate filament protein; Region: Filament; pfam00038" /db_xref="CDD:459643" polyA_site 1610 /gene="vimr2" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
atcttgtcttttctcttgtgctgctgtcatggctctgctgagagtgtcttcataccgtaagctgtttgaggaggagcagacgagtctggctgcaggacgctgtggagtccaggcccgcttcactgcaaggggtggagtgtcagagattgaatgtcctgagctggattttgcagcagctcgtgcactaaacaaggagggtgcgtctcgatttgtccatgagcgttctgtcatcgctgccctcaatgatcgcctcgccggactcatcgatgtggttcggggattagaagaagagaacgagtctctggaggctgagatcattgagctgaaggagaagaaagagtcagaacagatctccaccaccaccgtcagcatcagagaccctgccgacttcagcctggatgctgtgatagagaggctgcgcaaagaaaaggaggagattttgtgtaacacggaggagctgaagggtgaactgcggtgtctgcagatgaaatgtgatcaggtggtggagcacaggactctcatccagcaagagcgagaggatgtttctgtggaggtggatgcaattaccactgactgcctggcccttcgagaacaagttggcatctatgaggagcagctggctgctatggagaggcagcatgaaatgaggctggaaaatctgtgtgagcccgggcctctggatgaaggtttttcaactgtatccttacagttccctccctttgacataacaccagccatcatggatatcaaggggtactataggacactggctgaaaatctcaagtttgagttcaaaggctcgcacgccgccgccgttgatgccgcaggaaaggagaaaaaggaggagcagctggccaggttgactggagggaaagtgaaggacatctctaaagagactgatgtgaatgtcctcaaagacttgagtgcagagctggagaaagagttggcagagctgaagaaacatggagatgagttggagagtgaagtaaaagctagaaaagccaaaaacctggaggaaattgaagagctggagaattacatttctcagctcgacgaggaggaggctgatcttcagttccagataaaggatcaaagtgaggactatgaagaactgctgaatcagaagatgaatttagacatagagattgctgcttacaggggtttggttgaagaagaagaggaaagactgagctgcctgtaagatgcaagaacaggtgatgctctcctctggactgaagcaaacgcataaaaacactaaaaccgcatgtagttcaacccttaacagcaagtctcacaaatcaggcaggtaaagaaaacagctgtcagacacacttaaccttctgaacagatgtaaaccttcactgacagctgaagttcagggagtttgtgtaagctcattgataacgggtcagtggcaggtaacctgggtcttgaagaaaccccaggatctgttcagcagtgggagtgtgtgctgagagtgatggggggattattagcacagagactgggagtttcattaatgcacattcctatatacagatacactactgttcaaaagttgggggcgagtaaggttttattaaacagaaagcattacttttattcagcaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]