LOCUS       NR_045222                 88 bp    RNA     linear   VRT 25-JUN-2025
DEFINITION  Danio rerio microRNA 9-6 (mir9-6), microRNA.
ACCESSION   NR_045222
VERSION     NR_045222.2
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 88)
  AUTHORS   Soto,X., Burton,J., Manning,C.S., Minchington,T., Lea,R., Lee,J.,
            Kursawe,J., Rattray,M. and Papalopulu,N.
  TITLE     Sequential and additive expression of miR-9 precursors control
            timing of neurogenesis
  JOURNAL   Development 149 (19) (2022)
   PUBMED   36189829
REFERENCE   2  (bases 1 to 88)
  AUTHORS   Katz,S., Cussigh,D., Urban,N., Blomfield,I., Guillemot,F.,
            Bally-Cuif,L. and Coolen,M.
  TITLE     A Nuclear Role for miR-9 and Argonaute Proteins in Balancing
            Quiescent and Activated Neural Stem Cell States
  JOURNAL   Cell Rep 17 (5), 1383-1398 (2016)
   PUBMED   27783951
REFERENCE   3  (bases 1 to 88)
  AUTHORS   King,B.L. and Yin,V.P.
  TITLE     A Conserved MicroRNA Regulatory Circuit Is Differentially
            Controlled during Limb/Appendage Regeneration
  JOURNAL   PLoS One 11 (6), e0157106 (2016)
   PUBMED   27355827
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 88)
  AUTHORS   Nepal,C., Coolen,M., Hadzhiev,Y., Cussigh,D., Mydel,P., Steen,V.M.,
            Carninci,P., Andersen,J.B., Bally-Cuif,L., Muller,F. and Lenhard,B.
  TITLE     Transcriptional, post-transcriptional and chromatin-associated
            regulation of pri-miRNAs, pre-miRNAs and moRNAs
  JOURNAL   Nucleic Acids Res 44 (7), 3070-3081 (2016)
   PUBMED   26673698
REFERENCE   5  (bases 1 to 88)
  AUTHORS   Coolen,M., Katz,S. and Bally-Cuif,L.
  TITLE     miR-9: a versatile regulator of neurogenesis
  JOURNAL   Front Cell Neurosci 7, 220 (2013)
   PUBMED   24312010
  REMARK    Review article
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 88)
  AUTHORS   Leucht,C., Stigloher,C., Wizenmann,A., Klafke,R., Folchert,A. and
            Bally-Cuif,L.
  TITLE     MicroRNA-9 directs late organizer activity of the
            midbrain-hindbrain boundary
  JOURNAL   Nat Neurosci 11 (6), 641-648 (2008)
   PUBMED   18454145
REFERENCE   7  (bases 1 to 88)
  AUTHORS   Kapsimali,M., Kloosterman,W.P., de Bruijn,E., Rosa,F.,
            Plasterk,R.H. and Wilson,S.W.
  TITLE     MicroRNAs show a wide diversity of expression profiles in the
            developing and mature central nervous system
  JOURNAL   Genome Biol 8 (8), R173 (2007)
   PUBMED   17711588
REFERENCE   8  (bases 1 to 88)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   9  (bases 1 to 88)
  AUTHORS   Wienholds,E., Kloosterman,W.P., Miska,E., Alvarez-Saavedra,E.,
            Berezikov,E., de Bruijn,E., Horvitz,H.R., Kauppinen,S. and
            Plasterk,R.H.
  TITLE     MicroRNA expression in zebrafish embryonic development
  JOURNAL   Science 309 (5732), 310-311 (2005)
   PUBMED   15919954
REFERENCE   10 (bases 1 to 88)
  AUTHORS   Chen,P.Y., Manninga,H., Slanchev,K., Chien,M., Russo,J.J., Ju,J.,
            Sheridan,R., John,B., Marks,D.S., Gaidatzis,D., Sander,C.,
            Zavolan,M. and Tuschl,T.
  TITLE     The developmental miRNA profiles of zebrafish as determined by
            small RNA cloning
  JOURNAL   Genes Dev 19 (11), 1288-1293 (2005)
   PUBMED   15937218
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JBMGRA010000007.1.
            
            On Jun 25, 2025 this sequence version replaced NR_045222.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM609099.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-88                JBMGRA010000007.1  14382418-14382505   c
FEATURES             Location/Qualifiers
     source          1..88
                     /organism="Danio rerio"
                     /mol_type="transcribed RNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="7"
                     /map="7"
     gene            1..88
                     /gene="mir9-6"
                     /gene_synonym="mirn9-6"
                     /note="microRNA 9-6"
                     /db_xref="GeneID:100191018"
                     /db_xref="miRBase:MI0001885"
                     /db_xref="ZFIN:ZDB-MIRNAG-081013-4"
     precursor_RNA   1..88
                     /gene="mir9-6"
                     /gene_synonym="mirn9-6"
                     /product="microRNA 9-6"
                     /db_xref="GeneID:100191018"
                     /db_xref="miRBase:MI0001885"
                     /db_xref="ZFIN:ZDB-MIRNAG-081013-4"
     exon            1..88
                     /gene="mir9-6"
                     /gene_synonym="mirn9-6"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           15..37
                     /ncRNA_class="miRNA"
                     /gene="mir9-6"
                     /gene_synonym="mirn9-6"
                     /product="dre-miR-9-5p"
                     /db_xref="miRBase:MIMAT0001769"
                     /db_xref="GeneID:100191018"
                     /db_xref="miRBase:MI0001885"
                     /db_xref="ZFIN:ZDB-MIRNAG-081013-4"
     ncRNA           55..75
                     /ncRNA_class="miRNA"
                     /gene="mir9-6"
                     /gene_synonym="mirn9-6"
                     /product="dre-miR-9-3p"
                     /db_xref="miRBase:MIMAT0003156"
                     /db_xref="GeneID:100191018"
                     /db_xref="miRBase:MI0001885"
                     /db_xref="ZFIN:ZDB-MIRNAG-081013-4"
ORIGIN      

ggaggtagttgctatctttggttatctagctgtatgagtgtttatctgccttcataaagctagataaccgaaagtagaaacgtcctcc

//