2025-08-23 17:56:39, GGRNA.v2 : RefSeq release 230 (May, 2025)
LOCUS NM_131700 1298 bp mRNA linear VRT 06-APR-2025 DEFINITION Danio rerio ventral expressed homeobox (vent), mRNA. ACCESSION NM_131700 VERSION NM_131700.1 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 1298) AUTHORS Li,Y., Yan,Y., Gong,B., Zheng,Q., Zhou,H., Sun,J., Li,M., Wang,Z., Li,Y., Wan,Y., Chen,W., Qi,S., Mo,X., Meng,A., Xiang,B. and Chen,J. TITLE A Huluwa phosphorylation switch regulates embryonic axis induction JOURNAL Nat Commun 15 (1), 10028 (2024) PUBMED 39562571 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 1298) AUTHORS Mao,A., Li,Z., Ning,G., Zhou,Z., Wei,C., Li,J., He,X. and Wang,Q. TITLE Sclerotome-derived PDGF signaling functions as a niche cue responsible for primitive erythropoiesis JOURNAL Development 150 (22) (2023) PUBMED 37882745 REFERENCE 3 (bases 1 to 1298) AUTHORS Zhang,W., Scerbo,P., Delagrange,M., Candat,V., Mayr,V., Vriz,S., Distel,M., Ducos,B. and Bensimon,D. TITLE Fgf8 dynamics and critical slowing down may account for the temperature independence of somitogenesis JOURNAL Commun Biol 5 (1), 113 (2022) PUBMED 35132142 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 1298) AUTHORS Wang,B., Rong,X., Zhou,Y., Liu,Y., Sun,J., Zhao,B., Deng,B., Lu,L., Lu,L., Li,Y. and Zhou,J. TITLE Eukaryotic initiation factor 4A3 inhibits Wnt/beta-catenin signaling and regulates axis formation in zebrafish embryos JOURNAL Development 148 (9) (2021) PUBMED 33914867 REFERENCE 5 (bases 1 to 1298) AUTHORS Lin,C.Y., Lu,M.J., Yue,J.X., Li,K.L., Le Petillon,Y., Yong,L.W., Chen,Y.H., Tsai,F.Y., Lyu,Y.F., Chen,C.Y., Hwang,S.L., Su,Y.H. and Yu,J.K. TITLE Molecular asymmetry in the cephalochordate embryo revealed by single-blastomere transcriptome profiling JOURNAL PLoS Genet 16 (12), e1009294 (2020) PUBMED 33382716 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 1298) AUTHORS Gilardelli,C.N., Pozzoli,O., Sordino,P., Matassi,G. and Cotelli,F. TITLE Functional and hierarchical interactions among zebrafish vox/vent homeobox genes JOURNAL Dev Dyn 230 (3), 494-508 (2004) PUBMED 15188434 REMARK GeneRIF: vent plays a critical role in the development of the dorsoventral axis. REFERENCE 7 (bases 1 to 1298) AUTHORS Tsang,M., Maegawa,S., Kiang,A., Habas,R., Weinberg,E. and Dawid,I.B. TITLE A role for MKP3 in axial patterning of the zebrafish embryo JOURNAL Development 131 (12), 2769-2779 (2004) PUBMED 15142973 REFERENCE 8 (bases 1 to 1298) AUTHORS Sidi,S., Goutel,C., Peyrieras,N. and Rosa,F.M. TITLE Maternal induction of ventral fate by zebrafish radar JOURNAL Proc Natl Acad Sci U S A 100 (6), 3315-3320 (2003) PUBMED 12601179 REFERENCE 9 (bases 1 to 1298) AUTHORS Shimizu,T., Yamanaka,Y., Nojima,H., Yabe,T., Hibi,M. and Hirano,T. TITLE A novel repressor-type homeobox gene, ved, is involved in dharma/bozozok-mediated dorsal organizer formation in zebrafish JOURNAL Mech Dev 118 (1-2), 125-138 (2002) PUBMED 12351176 REMARK GeneRIF: ved functions redundantly with vox/vega1 and vent/vega2 to restrict the organizer domain in zebrafish REFERENCE 10 (bases 1 to 1298) AUTHORS Imai,Y., Gates,M.A., Melby,A.E., Kimelman,D., Schier,A.F. and Talbot,W.S. TITLE The homeobox genes vox and vent are redundant repressors of dorsal fates in zebrafish JOURNAL Development 128 (12), 2407-2420 (2001) PUBMED 11493559 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AF255044.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF255044.1, AW128696.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA898401, SAMN06645146 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..1298 /organism="Danio rerio" /mol_type="mRNA" /db_xref="taxon:7955" /chromosome="13" /map="13" gene 1..1298 /gene="vent" /gene_synonym="vega2; vent1; wu:fe36b11" /note="ventral expressed homeobox" /db_xref="GeneID:64810" /db_xref="ZFIN:ZDB-GENE-010108-2" misc_feature 70..72 /gene="vent" /gene_synonym="vega2; vent1; wu:fe36b11" /note="upstream in-frame stop codon" CDS 88..600 /gene="vent" /gene_synonym="vega2; vent1; wu:fe36b11" /codon_start=1 /product="ventral expressed homeobox" /protein_id="NP_571775.1" /db_xref="GeneID:64810" /db_xref="ZFIN:ZDB-GENE-010108-2" /translation="
MIPSKFSVEWLSQSFHDQEKCSTAAPGAPLTAAAGAGKAPASPANSCGYTDVESDDSEVEAGQNRRVRTKFTCDQISGLEKSFSKHRYLGATQRRKIAEKLHLSETQVKTWFQNRRMKLKREVQDMRAADFLYPAVFPPMTSLQHQSVGYYHQQQPQHITHPMLFTRCYF"
misc_feature 280..450 /gene="vent" /gene_synonym="vega2; vent1; wu:fe36b11" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" ORIGIN
ggcacgagggcgcctccataaagtctacagacctcttgaggacttctaaacacgctttttcttcttctttagcccagaacaagcatcatgatacccagcaagttctcagtggagtggctctcccagagtttccatgatcaggagaaatgcagcacagcagctcctggagctccactaacagcggctgcaggagcagggaaggccccggcgtcacccgccaacagctgtggatacaccgatgtggagagtgatgacagtgaagtagaagcggggcagaatcgacgcgtcaggaccaaattcacctgcgatcagatctctggcctggagaagagcttcagcaaacaccgctacctcggagcaactcagaggaggaagatagcggagaaactgcacctgtcagaaactcaggtgaagacgtggtttcagaaccggcggatgaagctgaagcgtgaggtgcaggacatgcgtgccgcagacttcctctatcccgctgtttttccaccgatgacgtcacttcagcaccaaagcgtggggtactaccaccagcagcagccgcagcacatcacacacccgatgctgttcacacgctgctacttctaaacgtctcctgtgtggaattatatttgtgcgataattctatgcacaaaaggtcatgttttgagtacacaaagtcatcatgatcttatgtgtgcaaaattgttaacaaacatgcaatgtcactttacatgctcaaaacatgactttttgcatgcagacttgttaacatgcacacaacctgcaatttttcaagctcaaaacatgatcttttgcatgcaaaattgttaacacacatgcaacaagccattttggatggtcaaaacaggatcttatgtgtgcaagttgttcacacacacacaaccggcgattttgcatgctcaaaacatgatcttttgaacaaagaattgttaacgcgcatgcaacaagtcattttacatgctcaaaacatgatcttttgtgtgcaaaattgttaattgacttgcaacaaggcattttacatgctcaagacaggatttttttgcatgcaaaattgttacactcatgcaacaagtcattttggatgcttaaagcatgatcttttgcatgaaaaattgttagcgcacatgcaaccagcaattttgcacgctctaaacatgatctcttgcatgcagaattgttaacaaacatacaactagcaatttttttatgctcaaaaaatgatcttttgtgtgcaaaattgttaattgacttgcaacaaggcattttgcatgctcaagacagga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]