GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-04-24 20:56:13, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_131462               1712 bp    mRNA    linear   VRT 14-DEC-2025
DEFINITION  Danio rerio visual system homeobox 2 (vsx2), mRNA.
ACCESSION   NM_131462 XM_001334034
VERSION     NM_131462.3
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 1712)
  AUTHORS   Bulk,J., Kyrychenko,V. and Heermann,S.
  TITLE     Ophthalmologic Findings in an Induced Model of Holoprosencephaly in
            Zebrafish
  JOURNAL   J Comp Neurol 533 (11), e70113 (2025)
   PUBMED   41207878
REFERENCE   2  (bases 1 to 1712)
  AUTHORS   Jing,Y., Luo,Y., Li,L., Liu,M. and Liu,J.X.
  TITLE     Deficiency of copper responsive gene stmn4 induces retinal
            developmental defects
  JOURNAL   Cell Biol Toxicol 40 (1), 2 (2024)
   PUBMED   38252267
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1712)
  AUTHORS   England,S.J., Rusnock,A.K., Mujcic,A., Kowalchuk,A., de Jager,S.,
            Hilinski,W.C., Juarez-Morales,J.L., Smith,M.E., Grieb,G.,
            Banerjee,S. and Lewis,K.E.
  TITLE     Molecular analyses of zebrafish V0v spinal interneurons and
            identification of transcriptional regulators downstream of Evx1 and
            Evx2 in these cells
  JOURNAL   Neural Dev 18 (1), 8 (2023)
   PUBMED   38017520
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1712)
  AUTHORS   Sun,K., Han,Y., Li,J., Yu,S., Huang,Y., Zhang,Y., Reilly,J., Tu,J.,
            Gao,P., Jia,D., Chen,X., Hu,H., Ren,M., Li,P., Luo,J., Ren,X.,
            Zhang,X., Shu,X., Liu,F., Liu,M. and Tang,Z.
  TITLE     The splicing factor DHX38 enables retinal development through
            safeguarding genome integrity
  JOURNAL   iScience 26 (11), 108103 (2023)
   PUBMED   37867960
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1712)
  AUTHORS   Letelier,J., Buono,L., Almuedo-Castillo,M., Zang,J., Mounieres,C.,
            Gonzalez-Diaz,S., Polvillo,R., Sanabria-Reinoso,E., Corbacho,J.,
            Sousa-Ortega,A., Diez Del Corral,R., Neuhauss,S.C.F. and
            Martinez-Morales,J.R.
  TITLE     Mutation of vsx genes in zebrafish highlights the robustness of the
            retinal specification network
  JOURNAL   Elife 12, e85594 (2023)
   PUBMED   37227126
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1712)
  AUTHORS   Link,B.A., Kainz,P.M., Ryou,T. and Dowling,J.E.
  TITLE     The perplexed and confused mutations affect distinct stages during
            the transition from proliferating to post-mitotic cells within the
            zebrafish retina
  JOURNAL   Dev Biol 236 (2), 436-453 (2001)
   PUBMED   11476583
REFERENCE   7  (bases 1 to 1712)
  AUTHORS   Link,B.A., Fadool,J.M., Malicki,J. and Dowling,J.E.
  TITLE     The zebrafish young mutation acts non-cell-autonomously to uncouple
            differentiation from specification for all retinal cells
  JOURNAL   Development 127 (10), 2177-2188 (2000)
   PUBMED   10769241
REFERENCE   8  (bases 1 to 1712)
  AUTHORS   Passini,M.A., Kurtzman,A.L., Canger,A.K., Asch,W.S., Wray,G.A.,
            Raymond,P.A. and Schechter,N.
  TITLE     Cloning of zebrafish vsx1: expression of a paired-like homeobox
            gene during CNS development
  JOURNAL   Dev Genet 23 (2), 128-141 (1998)
   PUBMED   9770270
REFERENCE   9  (bases 1 to 1712)
  AUTHORS   Passini,M.A., Levine,E.M., Canger,A.K., Raymond,P.A. and
            Schechter,N.
  TITLE     Vsx-1 and Vsx-2: differential expression of two paired-like
            homeobox genes during zebrafish and goldfish retinogenesis
  JOURNAL   J Comp Neurol 388 (3), 495-505 (1997)
   PUBMED   9368856
REFERENCE   10 (bases 1 to 1712)
  AUTHORS   Barabino,S.M., Spada,F., Cotelli,F. and Boncinelli,E.
  TITLE     Inactivation of the zebrafish homologue of Chx10 by antisense
            oligonucleotides causes eye malformations similar to the ocular
            retardation phenotype
  JOURNAL   Mech Dev 63 (2), 133-143 (1997)
   PUBMED   9203137
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JBMGRA010000017.1.
            
            On Jun 25, 2025 this sequence version replaced NM_131462.2.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC055588.1, U62898.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA3505373,
                                           SAMEA3505385 [ECO:0006172]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-493               JBMGRA010000017.1  33243917-33244409   c
            494-578             JBMGRA010000017.1  33243442-33243526   c
            579-702             JBMGRA010000017.1  33242628-33242751   c
            703-883             JBMGRA010000017.1  33239188-33239368   c
            884-1712            JBMGRA010000017.1  33237373-33238201   c
FEATURES             Location/Qualifiers
     source          1..1712
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="17"
                     /map="17"
     gene            1..1712
                     /gene="vsx2"
                     /gene_synonym="alx; chx10; Vsx-2"
                     /note="visual system homeobox 2"
                     /db_xref="GeneID:796163"
                     /db_xref="ZFIN:ZDB-GENE-001222-1"
     exon            1..493
                     /gene="vsx2"
                     /gene_synonym="alx; chx10; Vsx-2"
                     /inference="alignment:Splign:2.1.0"
     CDS             73..1191
                     /gene="vsx2"
                     /gene_synonym="alx; chx10; Vsx-2"
                     /note="homeobox protein ALX; homeobox protein CHX10;
                     transcription factor VSX2; ceh-10 homeodomain containing
                     homolog"
                     /codon_start=1
                     /product="visual system homeobox 2"
                     /protein_id="NP_571537.3"
                     /db_xref="GeneID:796163"
                     /db_xref="ZFIN:ZDB-GENE-001222-1"
                     /translation="
MTGKDGAVLSESLNKSKSLCATENGGNNNPHLSKSSITHPPKCTGFGIQEILGLNKEPSSAPRSTLDSFPAGAHLLASRSMLGPAGVGVGVGMGLIGPGGIPSFYSQPAFLEVLSDAQNVHLQPLSRTVGPLEHNQSASSDSDDVSSSERKMSKSSLSQSKKRKKRRHRTIFTSYQLEELEKAFNEAHYPDVYAREMLAMKTELPEDRIQVWFQNRRAKWRKREKCWGRSSVMAEYGLYGAMVRHSIPLPESILKSAKDGIMDSCAPWLLGMHKKSLETAGHQSNEKSDVTQTPTNPKPDEAEAEERRTESPMSKEELRENSIAALRAKAQEHSAKVLGTVSSERLEHNMETTATEEKSSEQIDAKEEEKSS"
     misc_feature    580..738
                     /gene="vsx2"
                     /gene_synonym="alx; chx10; Vsx-2"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    1021..1077
                     /gene="vsx2"
                     /gene_synonym="alx; chx10; Vsx-2"
                     /note="OAR motif; Region: OAR; pfam03826"
                     /db_xref="CDD:461067"
     exon            494..578
                     /gene="vsx2"
                     /gene_synonym="alx; chx10; Vsx-2"
                     /inference="alignment:Splign:2.1.0"
     exon            579..702
                     /gene="vsx2"
                     /gene_synonym="alx; chx10; Vsx-2"
                     /inference="alignment:Splign:2.1.0"
     exon            703..883
                     /gene="vsx2"
                     /gene_synonym="alx; chx10; Vsx-2"
                     /inference="alignment:Splign:2.1.0"
     exon            884..1712
                     /gene="vsx2"
                     /gene_synonym="alx; chx10; Vsx-2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gtattgcgcctcggatgcctgtgcacaggggaccgactcgaaagcaaagaagggaatagtctcagaggcaccatgacaggaaaggatggggctgttttgtcggaaagtttgaacaaatcaaaatcgctgtgtgccaccgagaacgggggaaataacaatccacatctgtcaaagagcagcatcacacatccgccaaaatgcacgggtttcggcattcaggagatcttgggactaaataaagagccgtcctcggccccacggagcacactggactccttccccgccggggcgcaccttctggccagcaggtcgatgctcggtccggctggtgtcggtgttggggtcgggatgggattaattgggcctggaggtattccgtctttctacagtcagcccgcgtttctggaggttctgtcagacgcgcagaacgtgcacctccagccgctcagcaggacggtggggccgctggaacataaccagtctgccagctcagattcagatgatgtctcttcaagtgaaaggaaaatgtcaaagtcttcactgagccagagcaagaagagaaaaaagagacgacacagaacaatatttacatcttaccagctggaagaactggagaaagcttttaacgaggctcattatccggatgtgtacgccagagaaatgctggccatgaaaaccgagctgccggaggacagaatacaggtgtggtttcaaaaccggagggccaagtggaggaagcgggagaagtgttggggtcgcagtagcgtgatggcggaatacgggctctacggcgccatggtgcgtcactctatccctctgcccgagtctatactcaaatctgctaaagatggcatcatggactcctgtgccccctggcttctagggatgcacaagaagtccttggagacggctgggcaccaatcaaacgagaagtcagatgtcactcagacaccgaccaatcccaaaccggacgaggccgaggctgaggaaaggaggacagagtcaccaatgtccaaagaggaactgagggagaacagcattgctgctctcagggcaaaagcgcaggagcacagcgccaaagtgcttggaacagtttcctcagagagactagagcataacatggagacaacggcgacagaggagaagtccagcgaacagatagacgcaaaagaagaggaaaagagctcttagatcttgcactgtaacagcataaagcgtagaaaatgtctgggctgttttctcatcctcaacactggacttttaattcttcactttagcaggtcagcagcatttagaaatgtacagtattttgatagtagcattggttcatccatgcaacaggttgatagccttttttaaatagaggcctacaaaaatctcagccataacttctttttaagatcctagttttcagtcacttttgttatgagccatgtatagatcatcactcaaatgaagaattagaaatgtatgagactgaacaacatttgttttgagcatctgagattgagttacagcagctgcttcagtatttcaatcacttaaaaacacttgacttgggcttgtgcgttaaagacagttatattaatagatttaatttaatatatacaccttactcaataaaaccacaaaacacattgtaataagccattctattccattctaagccagttctattaggtttttccctaaaatgaaaatgtacttagcat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]