2025-05-17 03:22:41, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_131340 2198 bp mRNA linear VRT 25-FEB-2025 DEFINITION Danio rerio thyroid hormone receptor beta (thrb), mRNA. ACCESSION NM_131340 XM_687890 VERSION NM_131340.1 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 2198) AUTHORS Xu,Y., Zhang,S., Bao,Y., Luan,J., Fu,Z., Sun,M., Zhao,X. and Feng,X. TITLE Melatonin protects zebrafish pancreatic development and physiological rhythms from sodium propionate-induced disturbances via the hypothalamic-pituitary-thyroid axis JOURNAL J Sci Food Agric 104 (12), 7454-7463 (2024) PUBMED 38717324 REFERENCE 2 (bases 1 to 2198) AUTHORS Fagundes,T., Pannetier,P., Golz,L., Behnstedt,L., Morthorst,J., Vergauwen,L., Knapen,D., Holbech,H., Braunbeck,T. and Baumann,L. TITLE The generation gap in endocrine disruption: Can the integrated fish endocrine disruptor test (iFEDT) bridge the gap by assessing intergenerational effects of thyroid hormone system disruption? JOURNAL Aquat Toxicol 272, 106969 (2024) PUBMED 38824743 REFERENCE 3 (bases 1 to 2198) AUTHORS Ai,N., Han,C.R., Zhao,H., Cheng,S.Y. and Ge,W. TITLE Disruption of Thyroid Hormone Receptor Thrab Leads to Female Infertility in Zebrafish JOURNAL Endocrinology 165 (5) (2024) PUBMED 38527850 REFERENCE 4 (bases 1 to 2198) AUTHORS Yang,L., Tu,P.H., Zhang,C.X., Xie,R.R., Dong,M., Jing,Y., Chen,X., Wei,G. and Song,H.D. TITLE Influence of two anti-tumor drugs, pazopanib, and axitinib, on the development and thyroid-axis of zebrafish (Danio rerio) embryos/larvae JOURNAL Front Endocrinol (Lausanne) 14, 1204678 (2023) PUBMED 37600710 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 2198) AUTHORS Harper,M., Hu,Y., Donahue,J., Acosta,B., Dievenich Braes,F., Nguyen,S., Zeng,J., Barbaro,J., Lee,H., Bui,H. and McMenamin,S.K. TITLE Thyroid hormone regulates proximodistal patterning in fin rays JOURNAL Proc Natl Acad Sci U S A 120 (21), e2219770120 (2023) PUBMED 37186843 REFERENCE 6 (bases 1 to 2198) AUTHORS Takayama,S., Hostick,U., Haendel,M., Eisen,J. and Darimont,B. TITLE An F-domain introduced by alternative splicing regulates activity of the zebrafish thyroid hormone receptor alpha JOURNAL Gen Comp Endocrinol 155 (1), 176-189 (2008) PUBMED 17583703 REFERENCE 7 (bases 1 to 2198) AUTHORS Walpita,C.N., Van der Geyten,S., Rurangwa,E. and Darras,V.M. TITLE The effect of 3,5,3'-triiodothyronine supplementation on zebrafish (Danio rerio) embryonic development and expression of iodothyronine deiodinases and thyroid hormone receptors JOURNAL Gen Comp Endocrinol 152 (2-3), 206-214 (2007) PUBMED 17418841 REFERENCE 8 (bases 1 to 2198) AUTHORS Krasowski,M.D., Yasuda,K., Hagey,L.R. and Schuetz,E.G. TITLE Evolutionary selection across the nuclear hormone receptor superfamily with a focus on the NR1I subfamily (vitamin D, pregnane X, and constitutive androstane receptors) JOURNAL Nucl Recept 3, 2 (2005) PUBMED 16197547 REMARK Publication Status: Online-Only REFERENCE 9 (bases 1 to 2198) AUTHORS Liu,Y.W. and Chan,W.K. TITLE Thyroid hormones are important for embryonic to larval transitory phase in zebrafish JOURNAL Differentiation 70 (1), 36-45 (2002) PUBMED 11963654 REMARK GeneRIF: Data suggest that the embryonic to larval transitory phase is characterized by its dependency on the timely synthesis of thyroid hormone and the concomitant autoinductive increase in thyroid hormone receptor beta mRNA levels. REFERENCE 10 (bases 1 to 2198) AUTHORS Marchand,O., Safi,R., Escriva,H., Van Rompaey,E., Prunet,P. and Laudet,V. TITLE Molecular cloning and characterization of thyroid hormone receptors in teleost fish JOURNAL J Mol Endocrinol 26 (1), 51-65 (2001) PUBMED 11174854 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AF109732.1. On Jul 6, 2005 this sequence version replaced XM_687890.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF109732.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMEA3505370, SAMEA3505371 [ECO:0006172] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..2198 /organism="Danio rerio" /mol_type="mRNA" /db_xref="taxon:7955" /chromosome="19" /map="19" gene 1..2198 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /note="thyroid hormone receptor beta" /db_xref="GeneID:30607" /db_xref="ZFIN:ZDB-GENE-990415-268" exon 1..147 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /inference="alignment:Splign:2.1.0" exon 148..192 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /inference="alignment:Splign:2.1.0" exon 193..255 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /inference="alignment:Splign:2.1.0" exon 256..307 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /inference="alignment:Splign:2.1.0" exon 308..372 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /inference="alignment:Splign:2.1.0" misc_feature 345..347 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /note="upstream in-frame stop codon" CDS 366..1526 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /note="TRbeta1; nuclear receptor subfamily 1 group A member 2; thyroid hormone receptor beta-1; thyroid hormone receptor beta 2" /codon_start=1 /product="thyroid hormone receptor beta" /protein_id="NP_571415.1" /db_xref="GeneID:30607" /db_xref="ZFIN:ZDB-GENE-990415-268" /translation="
MSEQADKCNSRWKDEAMQNGYIPSYLDKDELCVVCGDKATGYHYRCITCEGCKGFFRRTIQKNLNPTYACKYEGKCVIDKVTRNQCQECRFKKCIAVGMATDLVLDDSKRLAKRKLIEENRERRRREELQKTVWDRPEPTQEEWEMIRVVTEAHMATNAQGNHWKQKRKFLPEDIGSAPIVNAPEGNKVDIEAFSQFTKIITPAITRVVDFAKKLPMFCELPCEDQIILLKGCCMEIMSLRAAVRYDPESDTLTLNGEMAVTRGQLKNGGLGVVSDAIFDLGVSLSSFNLDDSEVALLQAVILLSSDRPGLTSVERIERCQEEFLLAFEHYINYRKHKVAHFWPKLLMKVTDLRMIGACHASRFLHMKVECPTELFPPLFLEVFED"
misc_feature 456..716 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /note="DNA-binding domain of thyroid hormone receptors (TRs) is composed of two C4-type zinc fingers; Region: NR_DBD_TR; cd06961" /db_xref="CDD:143519" misc_feature order(459..461,468..470,510..512,519..521,573..575, 591..593,621..623,630..632) /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /note="zinc binding site [ion binding]; other site" /db_xref="CDD:143519" misc_feature order(489..497,513..518,522..524,528..530,534..539, 546..548,612..617,624..626,633..635,672..680,693..695, 702..707,711..716) /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143519" misc_feature order(489..491,498..500,663..665,669..674) /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /note="heterodimer interface [polypeptide binding]; other site" /db_xref="CDD:143519" misc_feature 786..1514 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /note="The ligand binding domain of thyroid hormone receptor, a members of a superfamily of nuclear receptors; Region: NR_LBD_TR; cd06935" /db_xref="CDD:132733" misc_feature order(945..947,954..959,963..968,975..977,984..986, 1068..1070,1077..1079,1089..1091,1125..1133,1161..1163, 1170..1172,1176..1178,1197..1199,1443..1445,1464..1466, 1503..1505) /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /note="ligand binding site [chemical binding]; other site" /db_xref="CDD:132733" misc_feature order(981..983,990..992,1002..1004,1032..1034,1044..1046, 1053..1055,1497..1502,1509..1511) /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /note="coactivator recognition site [polypeptide binding]; other site" /db_xref="CDD:132733" misc_feature order(1182..1184,1317..1319,1407..1409,1416..1421, 1428..1430,1437..1442,1446..1451) /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:132733" exon 373..423 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /inference="alignment:Splign:2.1.0" exon 424..524 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /inference="alignment:Splign:2.1.0" exon 525..672 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /inference="alignment:Splign:2.1.0" exon 673..878 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /inference="alignment:Splign:2.1.0" exon 879..1025 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /inference="alignment:Splign:2.1.0" exon 1026..1284 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /inference="alignment:Splign:2.1.0" exon 1285..2198 /gene="thrb" /gene_synonym="fj24f03; NR1A2; thr2; TR-beta; trb; TR[b]1; wu:fj24f03" /inference="alignment:Splign:2.1.0" ORIGIN
cttctttctgtgtcttcgggtccatgttggagttgatctgctctgctgggtcatttcaggccacgtatgtccgatcacaggagcaaacattaaagttacagagatatcaatgaaggacatacacacatgctgtgttgcagcttcgagggtctctcatctgaatgaatgcattgcccatgaagtcagcgatggggcgttgcaagaggggctctggctcttatgacatggtttagaggatgaaaggcaggatgtaaggctctgcttcttcataccactctgggacaacttcaaaatcacaaagcacgagatatcagcgagtctgtggacaacaaaagaatgatggttaaggcctaatatactgcagtatgtcagagcaagcagacaaatgcaactcccgctggaaagatgaggccatgcagaatgggtacataccaagttacctggacaaggatgagctgtgtgttgtttgtggagacaaagcaactggttatcactatcgctgcattacatgtgagggctgcaaaggtttctttcgacgcacaattcagaagaacttaaacccaacatacgcatgcaagtatgaaggaaagtgtgtcattgacaaagttacccgaaaccagtgccaagaatgtcgcttcaagaaatgcatcgctgttggcatggctacagacttggtattggatgacagtaaacgtttagccaagcggaagctgattgaggagaaccgtgaacgccgacggcgtgaggagctgcagaagactgtatgggatcgaccagagcccacacaggaagagtgggagatgatacgggttgtcacagaggcccatatggccacaaatgcccaaggcaaccactggaaacaaaagcgcaaattcctgccagaagacattggatcggcacctattgtcaatgcaccagaggggaacaaagtggacattgaagccttcagtcagtttacaaaaattatcacccccgccatcactcgtgtcgtggattttgccaaaaagctacccatgttctgtgagctgccttgtgaggaccagatcattttgctgaagggttgttgcatggagatcatgtctcttcgagcagcagtgcgttatgaccccgagagcgatactctgacgctaaacggggagatggctgtcacacggggccagctcaagaatgggggtttgggtgttgtctcagatgccatctttgatctgggtgtctcgctgtcctcttttaacttggacgattcagaggtggcgttgttacaagccgtgattctgctttcctctgatcgtccaggtttaacaagcgttgagcggatagagcgttgtcaggaggagtttcttttggcctttgaacattacatcaactaccgtaagcacaaggtggctcacttttggcccaaactgctgatgaaggtgacagacctgcgcatgattggtgcctgccatgccagccgcttcctgcacatgaaggtggaatgtcccacagagctctttccgcccctcttcctggaagtgtttgaagactgatggcaatccaatcaggccaagctgctcccaccaacaccaacctccacaaatcagacctctacagtctccctgttcctggtcatatgtttctagcactactgaacatcatttcattccatagagttaggagtagctctggggcctatttgatgggatccattccttttacaaagcgggtacatttgaatagcataaaaaaataaattctgttactattgttttgttttttcagaaatgtttgatatctggtcatagtgttggataccgctcaacagaaatgtatgaactatgcattcaggtttcatgtcacatcaggcctcagaaataagtcaaatagcgccacactgcaaaggataatagcaatattttgtttcaatttacgtccttattctattggtctataggtctttttaagcttatgttaagctataggttgtttattgttttgttccagaaccctgtaaagcacttacagtacctagaccgaatttcattacatcaataggcgcaaagtaaaatcacaattgtgggctatattattacaatacttttgtcctagacaaaatcactaaatggaaaatgcatttatacttgtaactttaatttgcatagtttaggagcagtaccacaaaaatagatcttagactctttattgtctcaggtttgtcagaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]