GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-24 10:19:08, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_131306               1302 bp    mRNA    linear   VRT 28-SEP-2024
DEFINITION  Danio rerio distal-less homeobox 5a (dlx5a), mRNA.
ACCESSION   NM_131306
VERSION     NM_131306.2
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 1302)
  AUTHORS   Liao,T., Xu,X., Wu,J., Xie,Y. and Yan,J.
  TITLE     Increased expression levels of DLX5 inhibit the development of the
            nervous system
  JOURNAL   Int J Dev Neurosci 83 (8), 728-739 (2023)
   PUBMED   37767888
REFERENCE   2  (bases 1 to 1302)
  AUTHORS   Yu,E.P.Y., Saxena,V., Perin,S. and Ekker,M.
  TITLE     Loss of dlx5a/dlx6a Locus Alters Non-Canonical Wnt Signaling and
            Meckel's Cartilage Morphology
  JOURNAL   Biomolecules 13 (9), 1347 (2023)
   PUBMED   37759750
  REMARK    GeneRIF: Loss of dlx5a/dlx6a Locus Alters Non-Canonical Wnt
            Signaling and Meckel's Cartilage Morphology.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1302)
  AUTHORS   Truong,B.T., Shull,L.C., Lencer,E., Bend,E.G., Field,M., Blue,E.E.,
            Bamshad,M.J., Skinner,C., Everman,D., Schwartz,C.E.,
            Flanagan-Steet,H. and Artinger,K.B.
  TITLE     PRDM1 DNA-binding zinc finger domain is required for normal limb
            development and is disrupted in split hand/foot malformation
  JOURNAL   Dis Model Mech 16 (4) (2023)
   PUBMED   37083955
REFERENCE   4  (bases 1 to 1302)
  AUTHORS   Tamaki,T., Yoshida,T., Shibata,E., Nishihara,H., Ochi,H. and
            Kawakami,A.
  TITLE     Splashed E-box and AP-1 motifs cooperatively drive regeneration
            response and shape regeneration abilities
  JOURNAL   Biol Open 12 (2) (2023)
   PUBMED   36636913
REFERENCE   5  (bases 1 to 1302)
  AUTHORS   Stenzel,A., Mumme-Monheit,A., Sucharov,J., Walker,M.,
            Mitchell,J.M., Appel,B. and Nichols,J.T.
  TITLE     Distinct and redundant roles for zebrafish her genes during
            mineralization and craniofacial patterning
  JOURNAL   Front Endocrinol (Lausanne) 13, 1033843 (2022)
   PUBMED   36578958
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1302)
  AUTHORS   Hauptmann,G., Soll,I. and Gerster,T.
  TITLE     The early embryonic zebrafish forebrain is subdivided into
            molecularly distinct transverse and longitudinal domains
  JOURNAL   Brain Res Bull 57 (3-4), 371-375 (2002)
   PUBMED   11922991
REFERENCE   7  (bases 1 to 1302)
  AUTHORS   Zerucha,T., Stuhmer,T., Hatch,G., Park,B.K., Long,Q., Yu,G.,
            Gambarotta,A., Schultz,J.R., Rubenstein,J.L. and Ekker,M.
  TITLE     A highly conserved enhancer in the Dlx5/Dlx6 intergenic region is
            the site of cross-regulatory interactions between Dlx genes in the
            embryonic forebrain
  JOURNAL   J Neurosci 20 (2), 709-721 (2000)
   PUBMED   10632600
REFERENCE   8  (bases 1 to 1302)
  AUTHORS   Amores,A., Force,A., Yan,Y.L., Joly,L., Amemiya,C., Fritz,A.,
            Ho,R.K., Langeland,J., Prince,V., Wang,Y.L., Westerfield,M.,
            Ekker,M. and Postlethwait,J.H.
  TITLE     Zebrafish hox clusters and vertebrate genome evolution
  JOURNAL   Science 282 (5394), 1711-1714 (1998)
   PUBMED   9831563
REFERENCE   9  (bases 1 to 1302)
  AUTHORS   Ellies,D.L., Langille,R.M., Martin,C.C., Akimenko,M.A. and Ekker,M.
  TITLE     Specific craniofacial cartilage dysmorphogenesis coincides with a
            loss of dlx gene expression in retinoic acid-treated zebrafish
            embryos
  JOURNAL   Mech Dev 61 (1-2), 23-36 (1997)
   PUBMED   9076675
REFERENCE   10 (bases 1 to 1302)
  AUTHORS   Stock,D.W., Ellies,D.L., Zhao,Z., Ekker,M., Ruddle,F.H. and
            Weiss,K.M.
  TITLE     The evolution of the vertebrate Dlx gene family
  JOURNAL   Proc Natl Acad Sci U S A 93 (20), 10858-10863 (1996)
   PUBMED   8855272
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            CU929240.7, EH449338.1 and EH606041.1.
            
            On Aug 27, 2015 this sequence version replaced NM_131306.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC083280.1, GFIL01008708.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA3505370, SAMEA3505389
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-62                CU929240.7         60013-60074         c
            63-930              EH449338.1         28-895
            931-1299            EH606041.1         1-369               c
            1300-1302           CU929240.7         58062-58064         c
FEATURES             Location/Qualifiers
     source          1..1302
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="19"
                     /map="19"
     gene            1..1302
                     /gene="dlx5a"
                     /gene_synonym="dlx4; zgc:101787"
                     /note="distal-less homeobox 5a"
                     /db_xref="GeneID:30569"
                     /db_xref="ZFIN:ZDB-GENE-990415-49"
     exon            1..527
                     /gene="dlx5a"
                     /gene_synonym="dlx4; zgc:101787"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    113..115
                     /gene="dlx5a"
                     /gene_synonym="dlx4; zgc:101787"
                     /note="upstream in-frame stop codon"
     CDS             173..1021
                     /gene="dlx5a"
                     /gene_synonym="dlx4; zgc:101787"
                     /note="distal-less homeobox protein 5a; distal-less
                     homeobox gene 4; distal-less homeobox gene 5a"
                     /codon_start=1
                     /product="homeobox protein Dlx5a"
                     /protein_id="NP_571381.2"
                     /db_xref="GeneID:30569"
                     /db_xref="ZFIN:ZDB-GENE-990415-49"
                     /translation="
MTGVFDRRIPSIKPADFQNPFQLSTMHHPSQESPTLPESTATDSGYYSPAGGVHHGYCSPNSGTYGKPLNAYQYQYHGVNGSSGNYSAKSYPDYGSYSTAYHQYAGTYNRVQSQPSPQEKETAEPEVRMVNGKPKKVRKPRTIYSSFQLAALQRRFQNTQYLALPERAELAASLGLTQTQVKIWFQNKRSKLKKIMKNGELPPEHSPSSSDPMACNSPQSPAVWDSQGPQRPHHQPQNINTAASTFLESASSSWYSSTGAMNSHLQAPGTLHSLALGSGTLY"
     misc_feature    263..523
                     /gene="dlx5a"
                     /gene_synonym="dlx4; zgc:101787"
                     /note="Homeobox protein distal-less-like N terminal;
                     Region: DLL_N; pfam12413"
                     /db_xref="CDD:463567"
     misc_feature    584..754
                     /gene="dlx5a"
                     /gene_synonym="dlx4; zgc:101787"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            528..712
                     /gene="dlx5a"
                     /gene_synonym="dlx4; zgc:101787"
                     /inference="alignment:Splign:2.1.0"
     exon            713..1302
                     /gene="dlx5a"
                     /gene_synonym="dlx4; zgc:101787"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atcctccctgcagtgcgtaacagcgcaatttaggatttaaccaagtctttgctgcggggcttaaagcagtcttcaagagagacgcttgacgcttgcacgcacaatgttagtgtagactctttggacccctatagagttagactgcctttttttacgtcgtcttatccaaactatgactggagtattcgacagaaggattccgagtattaaacctgcagattttcaaaacccttttcagctctccacgatgcatcatccgtctcaggaatctccaaccctaccggagtccacagccacggattctggctattacagccctgccggaggagttcatcatggctattgttcaccgaactcgggcacctatgggaaacctcttaatgcctatcagtaccaataccacggagtcaatggatcttctggaaattactctgcaaaatcctaccctgattacggctcatactccacagcgtatcaccaatacgcaggaacatataacagagtgcaatcacaaccgagcccgcaagaaaaagaaacagccgagcccgaagtaaggatggtcaacggaaaacccaaaaaagtccggaagccccgaaccatttactccagtttccagctcgcagctttacagagaaggtttcagaacacgcaatacctcgcgcttccagaaagagccgagctcgccgcatcgctgggactcacacagacacaggtgaaaatctggttccagaacaaaagatcaaaactaaagaagattatgaaaaacggcgaactgcccccagaacacagccccagctccagcgacccaatggcgtgtaactcaccgcagtctcccgcggtctgggactcacagggtcctcagagacctcaccatcagccgcaaaatattaacacagcggcatccacgtttctggaaagcgcgagctcttcgtggtattcctctaccggggcgatgaattctcaccttcaggcacccggcacgttacactcgttggcactcggatcaggaacgttgtactgaaaattgtttattatttttgttgtatattggactggttgttaacaatttttttgaggaatatgcaatgtatcgatatggcagtcctagaagaacgtgtataatgtgtaaattgtgtgcatgtaatttattgcatttggaagaattattaaatgttttaaatggacaatggacccaaacactctgaatggtgccttgaattttgacctcaacgcgtacatccgacgatgtgccaaaacattaaggacaaccccaaataaatgtgttttactttgattatcaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]