GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-08-23 17:57:19, GGRNA.v2 : RefSeq release 230 (May, 2025)

LOCUS       NM_131208               1369 bp    mRNA    linear   VRT 28-APR-2025
DEFINITION  Danio rerio LIM homeobox 3 (lhx3), mRNA.
ACCESSION   NM_131208
VERSION     NM_131208.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 1369)
  AUTHORS   Yan,C.Y., Wu,F.Y., Sun,F., Fang,Y., Zhang,R.J., Zhang,C.R.,
            Zhang,C.X., Wang,Z., Yang,R.M., Yang,L., Dong,M., Zhang,Q.Y.,
            Ye,X.P., Song,H.D. and Zhao,S.X.
  TITLE     The isl2a transcription factor regulates pituitary development in
            zebrafish
  JOURNAL   Front Endocrinol (Lausanne) 14, 920548 (2023)
   PUBMED   36824359
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1369)
  AUTHORS   Barker,C.M., Miles,K.D. and Doll,C.A.
  TITLE     Fmrp regulates neuronal balance in embryonic motor circuit
            formation
  JOURNAL   Front Neurosci 16, 962901 (2022)
   PUBMED   36408418
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1369)
  AUTHORS   Huang,C.X., Wang,Z., Cheng,J., Zhu,Z., Guan,N.N. and Song,J.
  TITLE     De novo establishment of circuit modules restores locomotion after
            spinal cord injury in adult zebrafish
  JOURNAL   Cell Rep 41 (4), 111535 (2022)
   PUBMED   36288693
REFERENCE   4  (bases 1 to 1369)
  AUTHORS   Buyse,G., Di Michele,M., Wijgaerts,A., Louwette,S.,
            Wittevrongel,C., Thys,C., Downes,K., Ceulemans,B., Van Esch,H., Van
            Geet,C. and Freson,K.
  TITLE     Unravelling the disease mechanism for TSPYL1 deficiency
  JOURNAL   Hum Mol Genet 29 (20), 3431-3442 (2020)
   PUBMED   33075815
REFERENCE   5  (bases 1 to 1369)
  AUTHORS   Bando,H., Gergics,P., Bohnsack,B.L., Toolan,K.P., Richter,C.E.,
            Shavit,J.A. and Camper,S.A.
  TITLE     Otx2b mutant zebrafish have pituitary, eye and mandible defects
            that model mammalian disease
  JOURNAL   Hum Mol Genet 29 (10), 1648-1657 (2020)
   PUBMED   32277752
REFERENCE   6  (bases 1 to 1369)
  AUTHORS   Zeller,J. and Granato,M.
  TITLE     The zebrafish diwanka gene controls an early step of motor growth
            cone migration
  JOURNAL   Development 126 (15), 3461-3472 (1999)
   PUBMED   10393124
REFERENCE   7  (bases 1 to 1369)
  AUTHORS   Kobayashi,M., Toyama,R., Takeda,H., Dawid,I.B. and Kawakami,K.
  TITLE     Overexpression of the forebrain-specific homeobox gene six3 induces
            rostral forebrain enlargement in zebrafish
  JOURNAL   Development 125 (15), 2973-2982 (1998)
   PUBMED   9655819
REFERENCE   8  (bases 1 to 1369)
  AUTHORS   Glasgow,E., Karavanov,A.A. and Dawid,I.B.
  TITLE     Neuronal and neuroendocrine expression of lim3, a LIM class
            homeobox gene, is altered in mutant zebrafish with axial signaling
            defects
  JOURNAL   Dev Biol 192 (2), 405-419 (1997)
   PUBMED   9441677
REFERENCE   9  (bases 1 to 1369)
  AUTHORS   Blader,P., Fischer,N., Gradwohl,G., Guillemot,F. and Strahle,U.
  TITLE     The activity of neurogenin1 is controlled by local cues in the
            zebrafish embryo
  JOURNAL   Development 124 (22), 4557-4569 (1997)
   PUBMED   9409673
REFERENCE   10 (bases 1 to 1369)
  AUTHORS   Masai,I., Heisenberg,C.P., Barth,K.A., Macdonald,R., Adamek,S. and
            Wilson,S.W.
  TITLE     floating head and masterblind regulate neuronal patterning in the
            roof of the forebrain
  JOURNAL   Neuron 18 (1), 43-57 (1997)
   PUBMED   9010204
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from U34590.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: U34590.1 [ECO:0000332]
            RNAseq introns              :: partial sample support SAMEA3505371,
                                           SAMEA3505377 [ECO:0000350]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1369
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /db_xref="taxon:7955"
                     /chromosome="5"
                     /map="5"
     gene            1..1369
                     /gene="lhx3"
                     /gene_synonym="lim3"
                     /note="LIM homeobox 3"
                     /db_xref="GeneID:30455"
                     /db_xref="ZFIN:ZDB-GENE-980526-131"
     misc_feature    123..125
                     /gene="lhx3"
                     /gene_synonym="lim3"
                     /note="upstream in-frame stop codon"
     CDS             144..1340
                     /gene="lhx3"
                     /gene_synonym="lim3"
                     /note="homeobox protein LIM-3; LIM homeobox protein 3"
                     /codon_start=1
                     /product="LIM/homeobox protein Lhx3"
                     /protein_id="NP_571283.1"
                     /db_xref="GeneID:30455"
                     /db_xref="ZFIN:ZDB-GENE-980526-131"
                     /translation="
MLLEHPGSSCQNAGNYTRYSSSQDIPVCAGCNQHIVDRFILKVLDRHWHSKCLKCSDCQSQLADKCFSRGDSVYCKDDFFKRFGTKCAACQQGIPPTQVVRRAQDFVYHLHCFACIVCKRQLATGDEYYLMEDSRLVCKADYETAKQREADSTAKRPRTTITAKQLETLKNAYNNSPKPARHVREQLSTETGLDMRVVQVWFQNRRAKEKRLKKDAGRQRWGQYFRNMKRSRGTSKSDKDSTQEDGMDSDAEVSFTDEPPMSDLGHSNGIYSSLSESSPALSRQGGNHPAFPLEHGAIIPSQEPYHDIQASSPYSLPQSPGPLQPLPRHQPLISSLVYPESGLPMAGQSGGQDMTPGVRMMAAGNGPSSDLSTGSSGGYPDFPASPASWLDEVDHAQF"
     misc_feature    216..380
                     /gene="lhx3"
                     /gene_synonym="lim3"
                     /note="The first LIM domain of Lhx3b; Region: LIM1_Lhx3b;
                     cd09467"
                     /db_xref="CDD:188851"
     misc_feature    order(225..227,234..236,288..290,297..299,306..308,
                     315..317,366..368,375..377)
                     /gene="lhx3"
                     /gene_synonym="lim3"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188851"
     misc_feature    402..569
                     /gene="lhx3"
                     /gene_synonym="lim3"
                     /note="The second LIM domain of Lhx3-Lhx4 family; Region:
                     LIM2_Lhx3_Lhx4; cd09376"
                     /db_xref="CDD:188762"
     misc_feature    order(402..404,411..413,468..470,477..479,486..488,
                     495..497,555..557,564..566)
                     /gene="lhx3"
                     /gene_synonym="lim3"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:188762"
     misc_feature    order(438..440,513..515)
                     /gene="lhx3"
                     /gene_synonym="lim3"
                     /note="Isl binding site; other site"
                     /db_xref="CDD:188762"
     misc_feature    606..776
                     /gene="lhx3"
                     /gene_synonym="lim3"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    765..1025
                     /gene="lhx3"
                     /gene_synonym="lim3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q90421.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1062..1337
                     /gene="lhx3"
                     /gene_synonym="lim3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q90421.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
ORIGIN      
gacttcagtcacacatccgaaaagttgcggagccccggagagctgttctgcttcacactccgctcactccagcacgcgtctgtctgtttttctttgctgcagaaactccggtctcgctagtttagtttatttttatcgccagaatgttgttagaacatccaggatcgagttgtcaaaatgctggaaattacaccagatacagctccagtcaagatatcccggtctgtgcgggctgtaatcagcacatcgtggatcgtttcatcctgaaggttctggatcgccactggcacagcaagtgtctgaaatgcagcgactgtcagtctcagctggccgacaaatgcttcagcagaggagacagcgtgtactgcaaagacgacttcttcaagaggtttggcaccaagtgcgcggcgtgtcagcaggggattccgccgacgcaggtggtccgcagggcgcaggatttcgtctatcacctgcactgcttcgcctgtatcgtgtgcaagaggcagctggccaccggggacgagtactacctgatggaggacagtcggctggtgtgcaaagcggactacgagacggccaaacagagagaggcggattcgacagcaaagcgaccccgcacgacaatcaccgccaagcagctcgagacgctgaaaaacgcgtacaacaactcaccgaaacccgcgcggcacgtgcgcgagcagctgtccacggaaaccggactggacatgcgcgttgtgcaggtctggtttcaaaacagaagagcaaaagagaagaggctgaagaaagatgcgggcagacaaagatggggccagtacttcagaaacatgaagaggtctcgcggcacgtccaaatcagacaaagacagcactcaggaggacggcatggacagcgacgcggaagtctctttcacagacgagccgcccatgtccgatttgggtcactccaatggcatctacagcagtctgagcgaaagttcaccagctctcagtcgccagggtggaaatcatccggcgtttccgttggagcacggtgctataatcccgtcgcaggaaccgtatcacgacatccaggccagcagcccctacagcctcccgcagtcgcccggcccactgcagcccttacccagacaccagccgctcatctccagcctggtctacccagagtctggcctgcccatggcgggtcaaagcggaggccaggacatgacgccgggggttcggatgatggctgcggggaacggcccgagctccgatctatccacgggaagcagcggcggatatccggatttccctgcgagcccggcgtcctggctggatgaagtggatcatgcccaattctgattcagtaaatctccatagactgcagcgat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]