GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-24 10:10:21, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_131181               1037 bp    mRNA    linear   VRT 07-DEC-2024
DEFINITION  Danio rerio homeobox B8b (hoxb8b), mRNA.
ACCESSION   NM_131181 XM_686884
VERSION     NM_131181.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 1037)
  AUTHORS   Sundaramoorthi,H., Fallatah,W., Mary,J. and Jagadeeswaran,P.
  TITLE     Discovery of seven hox genes in zebrafish thrombopoiesis
  JOURNAL   Blood Cells Mol Dis 104, 102796 (2024)
   PUBMED   37717409
REFERENCE   2  (bases 1 to 1037)
  AUTHORS   Yamada,K., Maeno,A., Araki,S., Kikuchi,M., Suzuki,M., Ishizaka,M.,
            Satoh,K., Akama,K., Kawabe,Y., Suzuki,K., Kobayashi,D., Hamano,N.
            and Kawamura,A.
  TITLE     An atlas of seven zebrafish hox cluster mutants provides insights
            into sub/neofunctionalization of vertebrate Hox clusters
  JOURNAL   Development 148 (11) (2021)
   PUBMED   34096572
REFERENCE   3  (bases 1 to 1037)
  AUTHORS   Pipal,M., Legradi,J., Smutna,M., Koci,T., Priebojova,J.,
            Blahova,L., Krauss,M. and Hilscherova,K.
  TITLE     Neurobehavioral effects of cyanobacterial biomass field extracts on
            zebrafish embryos and potential role of retinoids
  JOURNAL   Aquat Toxicol 228, 105613 (2020)
   PUBMED   32949975
REFERENCE   4  (bases 1 to 1037)
  AUTHORS   Malmstrom,M., Britz,R., Matschiner,M., Torresen,O.K., Hadiaty,R.K.,
            Yaakob,N., Tan,H.H., Jakobsen,K.S., Salzburger,W. and Ruber,L.
  TITLE     The Most Developmentally Truncated Fishes Show Extensive Hox Gene
            Loss and Miniaturized Genomes
  JOURNAL   Genome Biol Evol 10 (4), 1088-1103 (2018)
   PUBMED   29684203
REFERENCE   5  (bases 1 to 1037)
  AUTHORS   Pasquier,J., Cabau,C., Nguyen,T., Jouanno,E., Severac,D.,
            Braasch,I., Journot,L., Pontarotti,P., Klopp,C., Postlethwait,J.H.,
            Guiguen,Y. and Bobe,J.
  TITLE     Gene evolution and gene expression after whole genome duplication
            in fish: the PhyloFish database
  JOURNAL   BMC Genomics 17, 368 (2016)
   PUBMED   27189481
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1037)
  AUTHORS   Wang,Y., Qian,L., Dong,Y., Jiang,Q., Gui,Y., Zhong,T.P. and Song,H.
  TITLE     Myocyte-specific enhancer factor 2A is essential for zebrafish
            posterior somite development
  JOURNAL   Mech Dev 123 (10), 783-791 (2006)
   PUBMED   16942865
REFERENCE   7  (bases 1 to 1037)
  AUTHORS   Phillips,R.B., Amores,A., Morasch,M.R., Wilson,C. and
            Postlethwait,J.H.
  TITLE     Assignment of zebrafish genetic linkage groups to chromosomes
  JOURNAL   Cytogenet Genome Res 114 (2), 155-162 (2006)
   PUBMED   16825768
REFERENCE   8  (bases 1 to 1037)
  AUTHORS   Corredor-Adamez,M., Welten,M.C., Spaink,H.P., Jeffery,J.E.,
            Schoon,R.T., de Bakker,M.A., Bagowski,C.P., Meijer,A.H.,
            Verbeek,F.J. and Richardson,M.K.
  TITLE     Genomic annotation and transcriptome analysis of the zebrafish
            (Danio rerio) hox complex with description of a novel member, hox b
            13a
  JOURNAL   Evol Dev 7 (5), 362-375 (2005)
   PUBMED   16174031
REFERENCE   9  (bases 1 to 1037)
  AUTHORS   Santini,S. and Bernardi,G.
  TITLE     Organization and base composition of tilapia Hox genes:
            implications for the evolution of Hox clusters in fish
  JOURNAL   Gene 346, 51-61 (2005)
   PUBMED   15716008
REFERENCE   10 (bases 1 to 1037)
  AUTHORS   Davidson,A.J., Ernst,P., Wang,Y., Dekens,M.P., Kingsley,P.D.,
            Palis,J., Korsmeyer,S.J., Daley,G.Q. and Zon,L.I.
  TITLE     cdx4 mutants fail to specify blood progenitors and can be rescued
            by multiple hox genes
  JOURNAL   Nature 425 (6955), 300-306 (2003)
   PUBMED   13679919
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from BC162153.1.
            
            On May 8, 2009 this sequence version replaced XM_686884.3.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC162153.1, DQ060549.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA3505370, SAMEA3505371
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1037
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /db_xref="taxon:7955"
                     /chromosome="12"
                     /map="12"
     gene            1..1037
                     /gene="hoxb8b"
                     /gene_synonym="hoxa8; z-9"
                     /note="homeobox B8b"
                     /db_xref="GeneID:30420"
                     /db_xref="ZFIN:ZDB-GENE-980526-291"
     exon            1..631
                     /gene="hoxb8b"
                     /gene_synonym="hoxa8; z-9"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    145..147
                     /gene="hoxb8b"
                     /gene_synonym="hoxa8; z-9"
                     /note="upstream in-frame stop codon"
     CDS             208..951
                     /gene="hoxb8b"
                     /gene_synonym="hoxa8; z-9"
                     /note="hox-A8; homeobox protein Hox-A8; homeobox gene
                     B-8b; homeobox gene A-8; homeo box B8b"
                     /codon_start=1
                     /product="homeobox protein Hox-B8b"
                     /protein_id="NP_571256.1"
                     /db_xref="GeneID:30420"
                     /db_xref="ZFIN:ZDB-GENE-980526-291"
                     /translation="
MSSYFVNSLFTKFKGGDSLRSNYYDCPSYTPDLGGRPSVLYGHNTGSAFQHAAQFPDFYHHGTSSFPHASYQQTPCAVAYPGDATGNILGQDGLQKQSFFGAPDSDFTQFGDCNLKVSGIRDDLESAEPCTAQLFPWMRPQATGRRRGRQTYSRYQTLELEKEFLFNPYLTRKRRIEVSHALALTERQVKIWFQNRRMKWKKEHNKDKFPSSKAEQEEIERERQEGSQVSEKHTSGEEDSEASSNSK"
     misc_feature    607..624
                     /gene="hoxb8b"
                     /gene_synonym="hoxa8; z-9"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8JH55.1);
                     Region: Antp-type hexapeptide"
     misc_feature    643..813
                     /gene="hoxb8b"
                     /gene_synonym="hoxa8; z-9"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    808..948
                     /gene="hoxb8b"
                     /gene_synonym="hoxa8; z-9"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8JH55.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            632..1037
                     /gene="hoxb8b"
                     /gene_synonym="hoxa8; z-9"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
cggggaccgtcactaaggagtcatgtgggtgcagctacggatacatttgtttgcatgaatatttacgacattttacgcatataatttccacctggatgaattcgtttttattgcaatagcaggcctcaagcaacataatttatctagagatttctttatctcaacactgattgccaaagtttcaccggggagttgatctttcaagcaatgagttcctacttcgtcaattccctcttcactaaatttaaaggaggcgattctctgcgctccaactactatgactgcccaagctacacgccggatcttggaggcagaccatctgtgctgtacggtcacaacacaggatctgcgtttcagcacgcggctcagttcccggatttctaccaccacggtacatcatcattcccccacgcgtcttaccagcagaccccgtgcgcagttgcgtaccctggagatgccacgggaaacatcttgggccaggacggtttacagaaacagtcgttctttggcgcgccagattcggattttacgcagtttggggattgtaatttaaaggtcagcggtatcagggatgatctggagagtgcagaaccgtgcacagcgcaactcttcccatggatgagaccacaagctaccggacggaggaggggcaggcagacctacagccgctaccagacgttggagctggagaaggagttcctattcaatccttacctgacccgtaagcggcgcatcgaagtgtctcacgcactggccctcactgagaggcaggtaaagatctggttccagaacaggcgtatgaagtggaaaaaagaacacaacaaagacaagtttcccagcagcaaagcagaacaagaagaaattgagagagagaggcaagaggggagccaggtctcagaaaaacacacatctggagaagaggactcggaggcatctagcaattctaaatagtcttttgactataaaaacatcacaatcgatcaacttcaattaaataaaagtctgaagttcaaaaacgttcgtcgacatgcaaaggc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]