2025-04-24 10:10:21, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_131181 1037 bp mRNA linear VRT 07-DEC-2024 DEFINITION Danio rerio homeobox B8b (hoxb8b), mRNA. ACCESSION NM_131181 XM_686884 VERSION NM_131181.1 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 1037) AUTHORS Sundaramoorthi,H., Fallatah,W., Mary,J. and Jagadeeswaran,P. TITLE Discovery of seven hox genes in zebrafish thrombopoiesis JOURNAL Blood Cells Mol Dis 104, 102796 (2024) PUBMED 37717409 REFERENCE 2 (bases 1 to 1037) AUTHORS Yamada,K., Maeno,A., Araki,S., Kikuchi,M., Suzuki,M., Ishizaka,M., Satoh,K., Akama,K., Kawabe,Y., Suzuki,K., Kobayashi,D., Hamano,N. and Kawamura,A. TITLE An atlas of seven zebrafish hox cluster mutants provides insights into sub/neofunctionalization of vertebrate Hox clusters JOURNAL Development 148 (11) (2021) PUBMED 34096572 REFERENCE 3 (bases 1 to 1037) AUTHORS Pipal,M., Legradi,J., Smutna,M., Koci,T., Priebojova,J., Blahova,L., Krauss,M. and Hilscherova,K. TITLE Neurobehavioral effects of cyanobacterial biomass field extracts on zebrafish embryos and potential role of retinoids JOURNAL Aquat Toxicol 228, 105613 (2020) PUBMED 32949975 REFERENCE 4 (bases 1 to 1037) AUTHORS Malmstrom,M., Britz,R., Matschiner,M., Torresen,O.K., Hadiaty,R.K., Yaakob,N., Tan,H.H., Jakobsen,K.S., Salzburger,W. and Ruber,L. TITLE The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes JOURNAL Genome Biol Evol 10 (4), 1088-1103 (2018) PUBMED 29684203 REFERENCE 5 (bases 1 to 1037) AUTHORS Pasquier,J., Cabau,C., Nguyen,T., Jouanno,E., Severac,D., Braasch,I., Journot,L., Pontarotti,P., Klopp,C., Postlethwait,J.H., Guiguen,Y. and Bobe,J. TITLE Gene evolution and gene expression after whole genome duplication in fish: the PhyloFish database JOURNAL BMC Genomics 17, 368 (2016) PUBMED 27189481 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 1037) AUTHORS Wang,Y., Qian,L., Dong,Y., Jiang,Q., Gui,Y., Zhong,T.P. and Song,H. TITLE Myocyte-specific enhancer factor 2A is essential for zebrafish posterior somite development JOURNAL Mech Dev 123 (10), 783-791 (2006) PUBMED 16942865 REFERENCE 7 (bases 1 to 1037) AUTHORS Phillips,R.B., Amores,A., Morasch,M.R., Wilson,C. and Postlethwait,J.H. TITLE Assignment of zebrafish genetic linkage groups to chromosomes JOURNAL Cytogenet Genome Res 114 (2), 155-162 (2006) PUBMED 16825768 REFERENCE 8 (bases 1 to 1037) AUTHORS Corredor-Adamez,M., Welten,M.C., Spaink,H.P., Jeffery,J.E., Schoon,R.T., de Bakker,M.A., Bagowski,C.P., Meijer,A.H., Verbeek,F.J. and Richardson,M.K. TITLE Genomic annotation and transcriptome analysis of the zebrafish (Danio rerio) hox complex with description of a novel member, hox b 13a JOURNAL Evol Dev 7 (5), 362-375 (2005) PUBMED 16174031 REFERENCE 9 (bases 1 to 1037) AUTHORS Santini,S. and Bernardi,G. TITLE Organization and base composition of tilapia Hox genes: implications for the evolution of Hox clusters in fish JOURNAL Gene 346, 51-61 (2005) PUBMED 15716008 REFERENCE 10 (bases 1 to 1037) AUTHORS Davidson,A.J., Ernst,P., Wang,Y., Dekens,M.P., Kingsley,P.D., Palis,J., Korsmeyer,S.J., Daley,G.Q. and Zon,L.I. TITLE cdx4 mutants fail to specify blood progenitors and can be rescued by multiple hox genes JOURNAL Nature 425 (6955), 300-306 (2003) PUBMED 13679919 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from BC162153.1. On May 8, 2009 this sequence version replaced XM_686884.3. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC162153.1, DQ060549.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA3505370, SAMEA3505371 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..1037 /organism="Danio rerio" /mol_type="mRNA" /db_xref="taxon:7955" /chromosome="12" /map="12" gene 1..1037 /gene="hoxb8b" /gene_synonym="hoxa8; z-9" /note="homeobox B8b" /db_xref="GeneID:30420" /db_xref="ZFIN:ZDB-GENE-980526-291" exon 1..631 /gene="hoxb8b" /gene_synonym="hoxa8; z-9" /inference="alignment:Splign:2.1.0" misc_feature 145..147 /gene="hoxb8b" /gene_synonym="hoxa8; z-9" /note="upstream in-frame stop codon" CDS 208..951 /gene="hoxb8b" /gene_synonym="hoxa8; z-9" /note="hox-A8; homeobox protein Hox-A8; homeobox gene B-8b; homeobox gene A-8; homeo box B8b" /codon_start=1 /product="homeobox protein Hox-B8b" /protein_id="NP_571256.1" /db_xref="GeneID:30420" /db_xref="ZFIN:ZDB-GENE-980526-291" /translation="
MSSYFVNSLFTKFKGGDSLRSNYYDCPSYTPDLGGRPSVLYGHNTGSAFQHAAQFPDFYHHGTSSFPHASYQQTPCAVAYPGDATGNILGQDGLQKQSFFGAPDSDFTQFGDCNLKVSGIRDDLESAEPCTAQLFPWMRPQATGRRRGRQTYSRYQTLELEKEFLFNPYLTRKRRIEVSHALALTERQVKIWFQNRRMKWKKEHNKDKFPSSKAEQEEIERERQEGSQVSEKHTSGEEDSEASSNSK"
misc_feature 607..624 /gene="hoxb8b" /gene_synonym="hoxa8; z-9" /note="propagated from UniProtKB/Swiss-Prot (Q8JH55.1); Region: Antp-type hexapeptide" misc_feature 643..813 /gene="hoxb8b" /gene_synonym="hoxa8; z-9" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" misc_feature 808..948 /gene="hoxb8b" /gene_synonym="hoxa8; z-9" /note="propagated from UniProtKB/Swiss-Prot (Q8JH55.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" exon 632..1037 /gene="hoxb8b" /gene_synonym="hoxa8; z-9" /inference="alignment:Splign:2.1.0" ORIGIN
cggggaccgtcactaaggagtcatgtgggtgcagctacggatacatttgtttgcatgaatatttacgacattttacgcatataatttccacctggatgaattcgtttttattgcaatagcaggcctcaagcaacataatttatctagagatttctttatctcaacactgattgccaaagtttcaccggggagttgatctttcaagcaatgagttcctacttcgtcaattccctcttcactaaatttaaaggaggcgattctctgcgctccaactactatgactgcccaagctacacgccggatcttggaggcagaccatctgtgctgtacggtcacaacacaggatctgcgtttcagcacgcggctcagttcccggatttctaccaccacggtacatcatcattcccccacgcgtcttaccagcagaccccgtgcgcagttgcgtaccctggagatgccacgggaaacatcttgggccaggacggtttacagaaacagtcgttctttggcgcgccagattcggattttacgcagtttggggattgtaatttaaaggtcagcggtatcagggatgatctggagagtgcagaaccgtgcacagcgcaactcttcccatggatgagaccacaagctaccggacggaggaggggcaggcagacctacagccgctaccagacgttggagctggagaaggagttcctattcaatccttacctgacccgtaagcggcgcatcgaagtgtctcacgcactggccctcactgagaggcaggtaaagatctggttccagaacaggcgtatgaagtggaaaaaagaacacaacaaagacaagtttcccagcagcaaagcagaacaagaagaaattgagagagagaggcaagaggggagccaggtctcagaaaaacacacatctggagaagaggactcggaggcatctagcaattctaaatagtcttttgactataaaaacatcacaatcgatcaacttcaattaaataaaagtctgaagttcaaaaacgttcgtcgacatgcaaaggc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]