2025-07-03 13:46:34, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_131144 1020 bp mRNA linear VRT 25-FEB-2025 DEFINITION Danio rerio homeobox C5a (hoxc5a), mRNA. ACCESSION NM_131144 VERSION NM_131144.2 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 1020) AUTHORS Adachi,U., Koita,R., Seto,A., Maeno,A., Ishizu,A., Oikawa,S., Tani,T., Ishizaka,M., Yamada,K., Satoh,K., Nakazawa,H., Furudate,H., Kawakami,K., Iwanami,N., Matsuda,M. and Kawamura,A. TITLE Teleost Hox code defines regional identities competent for the formation of dorsal and anal fins JOURNAL Proc Natl Acad Sci U S A 121 (25), e2403809121 (2024) PUBMED 38861596 REFERENCE 2 (bases 1 to 1020) AUTHORS Sundaramoorthi,H., Fallatah,W., Mary,J. and Jagadeeswaran,P. TITLE Discovery of seven hox genes in zebrafish thrombopoiesis JOURNAL Blood Cells Mol Dis 104, 102796 (2024) PUBMED 37717409 REFERENCE 3 (bases 1 to 1020) AUTHORS Wang,H., He,J., Han,X., Wu,X., Ye,X., Lv,W. and Zu,Y. TITLE hoxa1a-Null Zebrafish as a Model for Studying HOXA1-Associated Heart Malformation in Bosley-Salih-Alorainy Syndrome JOURNAL Biology (Basel) 12 (7), 899 (2023) PUBMED 37508332 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 1020) AUTHORS Banu,S., Gaur,N., Nair,S., Ravikrishnan,T., Khan,S., Mani,S., Bharathi,S., Mandal,K., Kuram,N.A., Vuppaladadium,S., Ravi,R., Murthy,C.L.N., Quoseena,M., Babu,N.S. and Idris,M.M. TITLE Understanding the complexity of epimorphic regeneration in zebrafish caudal fin tissue: A transcriptomic and proteomic approach JOURNAL Genomics 114 (2), 110300 (2022) PUBMED 35134499 REFERENCE 5 (bases 1 to 1020) AUTHORS Yamada,K., Maeno,A., Araki,S., Kikuchi,M., Suzuki,M., Ishizaka,M., Satoh,K., Akama,K., Kawabe,Y., Suzuki,K., Kobayashi,D., Hamano,N. and Kawamura,A. TITLE An atlas of seven zebrafish hox cluster mutants provides insights into sub/neofunctionalization of vertebrate Hox clusters JOURNAL Development 148 (11) (2021) PUBMED 34096572 REFERENCE 6 (bases 1 to 1020) AUTHORS Snell,E.A., Scemama,J.L. and Stellwag,E.J. TITLE Genomic organization of the Hoxa4-Hoxa10 region from Morone saxatilis: implications for Hox gene evolution among vertebrates JOURNAL J Exp Zool 285 (1), 41-49 (1999) PUBMED 10327649 REFERENCE 7 (bases 1 to 1020) AUTHORS Gates,M.A., Kim,L., Egan,E.S., Cardozo,T., Sirotkin,H.I., Dougan,S.T., Lashkari,D., Abagyan,R., Schier,A.F. and Talbot,W.S. TITLE A genetic linkage map for zebrafish: comparative analysis and localization of genes and expressed sequences JOURNAL Genome Res 9 (4), 334-347 (1999) PUBMED 10207156 REFERENCE 8 (bases 1 to 1020) AUTHORS Prince,V.E., Joly,L., Ekker,M. and Ho,R.K. TITLE Zebrafish hox genes: genomic organization and modified colinear expression patterns in the trunk JOURNAL Development 125 (3), 407-420 (1998) PUBMED 9425136 REFERENCE 9 (bases 1 to 1020) AUTHORS Ekker,M., Speevak,M.D., Martin,C.C., Joly,L., Giroux,G. and Chevrette,M. TITLE Stable transfer of zebrafish chromosome segments into mouse cells JOURNAL Genomics 33 (1), 57-64 (1996) PUBMED 8617510 REFERENCE 10 (bases 1 to 1020) AUTHORS Geada,A.M., Coletta,P.L. and Sharpe,P.T. TITLE Characterization of the murine Hoxc-5 gene JOURNAL Mamm Genome 7 (1), 81-84 (1996) PUBMED 8903739 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from BX005254.9. On Aug 27, 2015 this sequence version replaced NM_131144.1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC163205.1, GFIL01012817.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA3505370, SAMEA3505371 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-551 BX005254.9 94968-95518 c 552-1020 BX005254.9 93681-94149 c FEATURES Location/Qualifiers source 1..1020 /organism="Danio rerio" /mol_type="mRNA" /strain="Tuebingen" /db_xref="taxon:7955" /chromosome="23" /map="23" gene 1..1020 /gene="hoxc5a" /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25" /note="homeobox C5a" /db_xref="GeneID:30379" /db_xref="ZFIN:ZDB-GENE-980526-533" exon 1..551 /gene="hoxc5a" /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25" /inference="alignment:Splign:2.1.0" misc_feature 44..46 /gene="hoxc5a" /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25" /note="upstream in-frame stop codon" CDS 65..766 /gene="hoxc5a" /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25" /note="homeobox gene C-5; homeo box C5a" /codon_start=1 /product="homeobox protein Hox-C5a" /protein_id="NP_571219.2" /db_xref="GeneID:30379" /db_xref="ZFIN:ZDB-GENE-980526-533" /translation="
MSSYVGKSFSKQTQDASSCRMHTFDNYGAHSEFHESNYAYEGLDLGGSFSSQIPTNSLRREAINTTDRARSSAAVQRTQSCSALGSRSFVSTHGYNPLSHGLLSQKAEGNMEVMEKPSGKSRTDDIKMETTSAIKQQTNSTQRQNQSQPQIYPWMTKLHMSHESDGKRSRTSYTRYQTLELEKEFHFNRYLTRRRRIEIANNLCLNERQIKIWFQNRRMKWKKDSKLKVKGGL"
misc_feature 563..733 /gene="hoxc5a" /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" exon 552..1020 /gene="hoxc5a" /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25" /inference="alignment:Splign:2.1.0" ORIGIN
cgtttctgcagtgaccgagtgttatttgtgagtctctttagggtgatattgtttgggaaatagcatgagctcatacgttgggaagtctttttctaagcagacgcaagacgcctcctcttgtagaatgcacacttttgacaactatggagctcacagtgagttccacgagtccaattacgcgtacgaagggcttgatctcggcggatccttcagttctcaaatccccaccaactctttgaggcgggaggcgataaacacaaccgaccgtgcaaggagcagtgcagcagttcagcgaacacagtcttgttcagctctgggctctcgtagctttgtaagcactcacgggtacaaccccctcagtcacggactgttgagccaaaaagccgaggggaatatggaagttatggagaagcccagcggcaagagccgcacagacgatatcaaaatggagactacttcagcgataaagcaacaaactaattcgactcagcgtcagaaccagtcgcagccgcagatatatccgtggatgacaaagctacacatgagccacgaatctgacggtaaaaggtcacgaaccagttacacccggtaccagactctggagttggagaaagagttccatttcaaccgatacctcacacgtcgcagacgtattgagattgccaataacctctgcttgaacgagcgccaaattaaaatatggttccagaaccgtcgcatgaagtggaagaaggactcaaagttgaaagtaaaaggaggactataaataatgtgttgcacgacttcaattacaacagcctgaaaataaaggcaatgttaacccttgaactaaaacaacgaatgatttaaaattgattttgttattaacaactgttgatgtctatcatttgtttacaatattatgttgttatgtgaatatgttgatattttcaatatttattgatagtgctctgtccccagtacggcagatgctaatttgaataatgtatgagcttaaacattgattatgctttactaaac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]