2025-09-13 16:57:48, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS NM_001160384 1350 bp mRNA linear VRT 16-SEP-2024 DEFINITION Danio rerio NK2 homeobox 4a (nkx2.4a), transcript variant 2, mRNA. ACCESSION NM_001160384 XM_001923297 XM_001923299 XM_001923300 VERSION NM_001160384.1 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 1350) AUTHORS Yan YL, Titus T, Desvignes T, BreMiller R, Batzel P, Sydes J, Farnsworth D, Dillon D, Wegner J, Phillips JB, Peirce J, Dowd J, Buck CL, Miller A, Westerfield M and Postlethwait JH. CONSRTM Undiagnosed Diseases Network TITLE A fish with no sex: gonadal and adrenal functions partition between zebrafish NR5A1 co-orthologs JOURNAL Genetics 217 (2) (2021) PUBMED 33724412 REMARK Erratum:[Genetics. 2021 May 17;218(1):. PMID: 33826717] REFERENCE 2 (bases 1 to 1350) AUTHORS Schredelseker T, Veit F, Dorsky RI and Driever W. TITLE Bsx Is Essential for Differentiation of Multiple Neuromodulatory Cell Populations in the Secondary Prosencephalon JOURNAL Front Neurosci 14, 525 (2020) PUBMED 32581684 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1350) AUTHORS Murphy PJ, Wu SF, James CR, Wike CL and Cairns BR. TITLE Placeholder Nucleosomes Underlie Germline-to-Embryo DNA Methylation Reprogramming JOURNAL Cell 172 (5), 993-1006 (2018) PUBMED 29456083 REFERENCE 4 (bases 1 to 1350) AUTHORS Pasquier J, Cabau C, Nguyen T, Jouanno E, Severac D, Braasch I, Journot L, Pontarotti P, Klopp C, Postlethwait JH, Guiguen Y and Bobe J. TITLE Gene evolution and gene expression after whole genome duplication in fish: the PhyloFish database JOURNAL BMC Genomics 17, 368 (2016) PUBMED 27189481 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 1350) AUTHORS Manoli M and Driever W. TITLE nkx2.1 and nkx2.4 genes function partially redundant during development of the zebrafish hypothalamus, preoptic region, and pallidum JOURNAL Front Neuroanat 8, 145 (2014) PUBMED 25520628 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 1350) AUTHORS Armant O, Marz M, Schmidt R, Ferg M, Diotel N, Ertzer R, Bryne JC, Yang L, Baader I, Reischl M, Legradi J, Mikut R, Stemple D, van IJcken W, van der Sloot A, Lenhard B, Strahle U and Rastegar S. TITLE Genome-wide, whole mount in situ analysis of transcriptional regulators in zebrafish embryos JOURNAL Dev Biol 380 (2), 351-362 (2013) PUBMED 23684812 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from BC162246.1. On or before May 24, 2009 this sequence version replaced XM_001923297.1, XM_001923299.1, XM_001923300.1. Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region compared to variant 1. This results in a shorter protein (isoform b) compared to isoform 1. ##Evidence-Data-START## Transcript exon combination :: BC162246.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA4476746, SAMEA4476776 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..1350 /organism="Danio rerio" /mol_type="mRNA" /db_xref="taxon:7955" /chromosome="17" /map="17" gene 1..1350 /gene="nkx2.4a" /gene_synonym="fi48a12; wu:fi48a12; zgc:171531" /note="NK2 homeobox 4a" /db_xref="GeneID:562300" /db_xref="ZFIN:ZDB-GENE-030131-6336" exon 1..552 /gene="nkx2.4a" /gene_synonym="fi48a12; wu:fi48a12; zgc:171531" /inference="alignment:Splign:2.1.0" misc_feature 177..179 /gene="nkx2.4a" /gene_synonym="fi48a12; wu:fi48a12; zgc:171531" /note="upstream in-frame stop codon" CDS 183..1193 /gene="nkx2.4a" /gene_synonym="fi48a12; wu:fi48a12; zgc:171531" /note="isoform 2 is encoded by transcript variant 2; NK2 homeobox 4 a" /codon_start=1 /product="NK2 homeobox 4a isoform 2" /protein_id="NP_001153856.1" /db_xref="GeneID:562300" /db_xref="ZFIN:ZDB-GENE-030131-6336" /translation="
MSLSPKHTTPFSVTDILSPIEETYKKFSGMESTGNLTSPLGAYRQPQVSQTGMQQHSMGHNATVATTYHMPHSVSQFSHSAMGGYCNGSIANMGDLPSYQETMRNSAAATGWYGANPDPRYSTSMNMTGMGTLTGMADTTKSIPPLHAAPRRKRRVLFSQAQVYELERRFKQQKYLSAPEREHLASMIHLTPTQVKIWFQNHRYKMKRQAKDKAAQQLQQEGNLCQQQQSPRRVAVPVLVKDGKPCQNGSNTPTPNQQQMQQQQNGGGVVLPTSSNSMNQHQSQQVNALVQAQDLEEMSPSPPSLHSQMNSMGQIDTSVDYTNNMVTSNLLYGRTW"
misc_feature 636..806 /gene="nkx2.4a" /gene_synonym="fi48a12; wu:fi48a12; zgc:171531" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" exon 553..1350 /gene="nkx2.4a" /gene_synonym="fi48a12; wu:fi48a12; zgc:171531" /inference="alignment:Splign:2.1.0" ORIGIN
tctggcgcctggctacaataaacctgagataagagtggccagggctcgcctccttctccaaggcgatcaatcggatctcaggcatactacaagcactctcttacgtcgacgtccacgagaacagagctgatacaacaacacggctgagctccaccaccaaatatctatctgctttctgaaccatgtcgctgagcccaaagcacacgacacctttctcagtgacagatattttgagcccaattgaggagacttacaagaagtttagtggcatggagagcactggaaacctcacatctccattgggagcctaccggcaacctcaggtgtcccagactggcatgcagcaacactccatgggccacaacgccactgttgcgaccacctaccacatgccacactcggtttcccagttctcgcacagtgcaatggggggctactgcaatggcagcattgccaacatgggggatctaccctcttatcaagaaactatgagaaatagcgcagcggcaacagggtggtacggcgccaatccagaccctagatactcaacaagtatgaacatgacaggaatgggcacgctgacaggcatggccgacaccaccaaatccatcccacctctacacgcagcgccaaggaggaaacgacgggtgctcttctctcaagcacaagtctacgaactggaaaggagatttaagcagcagaaatacctttcagcgccggaaagggaacatctggctagcatgatacatctcaccccgacgcaggtcaagatctggtttcagaatcatcgctacaagatgaagcgacaggccaaggacaaagcagcgcagcagcttcaacaggagggcaacctgtgtcaacaacagcagtcgccgaggagagtggctgtccctgtcttagtgaaggatggcaagccttgccaaaacggttccaacacgccgacgccaaaccaacagcaaatgcagcagcagcagaacggaggaggggtcgtgcttcctacctcgagcaattctatgaaccaacaccaaagccagcaggtcaacgcactggtccaggcccaagacctggaggaaatgtcccctagtccgccgtcacttcattcgcaaatgaacagtatgggccagatagacacttctgtagattacacaaataatatggtcacgtcaaatctgctttatggcagaacgtggtagaagaccagctattttttctccttcgcttcttctccacccataaacttaaaaatgatctgaattaaggactgcgcttgaggccaaaagcagacacgccgtgtacccgcgcgaagatttaaagcgggtgttcggatcaaaggagtgggtttttgggggt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]