2024-05-05 21:47:50, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_009860473 1117 bp mRNA linear INV 22-OCT-2018 DEFINITION PREDICTED: Ciona intestinalis nuclear factor interleukin-3-regulated protein-like (LOC104265765), transcript variant X1, mRNA. ACCESSION XM_009860473 VERSION XM_009860473.3 DBLINK BioProject: PRJNA187185 KEYWORDS RefSeq. SOURCE Ciona intestinalis (vase tunicate) ORGANISM Ciona intestinalis Eukaryota; Metazoa; Chordata; Tunicata; Ascidiacea; Phlebobranchia; Cionidae; Ciona. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_020170.2) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Oct 22, 2018 this sequence version replaced XM_009860473.2. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Ciona intestinalis Annotation Release 104 Annotation Version :: 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1117 /organism="Ciona intestinalis" /mol_type="mRNA" /db_xref="taxon:7719" /chromosome="5" gene 1..1117 /gene="LOC104265765" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 EST, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 159 samples with support for all annotated introns" /db_xref="GeneID:104265765" CDS 22..1059 /gene="LOC104265765" /codon_start=1 /product="nuclear factor interleukin-3-regulated protein-like isoform X1" /protein_id="XP_009858775.1" /db_xref="GeneID:104265765" /translation="
MNNNNLNNDDFPFVNNNRRSVGPPKLIPIGYLPNPTSFGSFPRFPNPLATNERQNHRQMQLPVRASTGSRRSRHFVPNECKDEYYWRKRKKNNEAARKSREKRKTIDSVLEDKVLFLSQENLCLRNELYALKVKYGEIDGTEAGANNLLSDKDHTDDLSMYSMLPSPSNSLSEVECKSSSNMCQRESTTPPVIYPEGPNEKDELAMHNLHKISELHTKTADGKFKDDDFEPTREVICQTREPHSILSNLAAGKFVLTSIDLPEKSPTQGVDLTIKSAARDSQAIAQNSVPGSDCVTYEAASVLVDLLKMSQNPQTPEKKLEDESGSKYNSSLPHKLRFKGRNLDV"
misc_feature 262..429 /gene="LOC104265765" /note="Basic leucine zipper (bZIP) domain of bZIP transcription factors: a DNA-binding and dimerization domain; Region: bZIP; cl21462" /db_xref="CDD:451253" misc_feature 274..429 /gene="LOC104265765" /note="coiled coil [structural motif]; Region: coiled coil" /db_xref="CDD:269834" misc_feature order(283..288,292..300,304..321,325..333) /gene="LOC104265765" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:269834" misc_feature order(328..330,337..342,349..354,358..363,370..375, 379..384,391..396,400..405,412..417,421..426) /gene="LOC104265765" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:269834" ORIGIN
agataattgttgttaaataatatgaataataacaacttaaataatgatgactttcctttcgtaaataacaatcgcagaagtgttggcccacccaagcttataccaattggatatcttcctaatccaacgtcatttggttcttttccacgatttccaaatccattagccacaaatgaacgacaaaaccatagacaaatgcaattgccagtacgggcaagcacggggagtcgcagaagtcgacattttgttccaaacgaatgcaaagatgaatattactggaggaaacgaaagaagaataacgaagcagcaagaaagtcccgagaaaagagaaaaacaattgattctgtgttagaagacaaggtcctatttctaagccaagaaaacttatgtttaagaaatgaattgtacgctttgaaggttaaatatggagaaattgatggaacagaggcaggtgcaaataatcttttgtcagacaaagaccacacagatgatctatctatgtattccatgctcccatccccatctaacagcctcagtgaagtagaatgcaaaagttcttcaaacatgtgtcaacgagaatccacaacaccaccagtcatttacccagaggggcccaacgaaaaggatgaattagcgatgcataatttgcacaaaatctcagagcttcacaccaaaacagcagatggcaaatttaaagatgatgattttgaacccacgcgtgaagtaatctgccaaacaagggaacctcattctattctatcaaacttagctgctggcaagtttgtcctcacgtcaattgatttacctgaaaaaagtccaactcaaggggttgatttgacaataaaatctgctgcaagagactctcaagctatagctcaaaactctgttccaggctcagactgtgtgacttatgaagctgcgagcgttctggttgacctgttaaaaatgtcgcagaatccacaaacgccagagaaaaaactagaggatgaaagtggcagcaaatataattctagtcttccccacaagttgcgatttaagggaagaaacttagatgtttaggatttggtggctataaggaattacacgcacactatacacagtaatcttcacatggctg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]