ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-04-24 22:32:15, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_002129655 806 bp mRNA linear INV 21-JAN-2026
DEFINITION PREDICTED: Ciona intestinalis small ribosomal subunit protein uS7
(LOC100186730), transcript variant X2, mRNA.
ACCESSION XM_002129655
VERSION XM_002129655.4
DBLINK BioProject: PRJNA1397229
KEYWORDS RefSeq.
SOURCE Ciona intestinalis (vase tunicate)
ORGANISM Ciona intestinalis
Eukaryota; Metazoa; Chordata; Tunicata; Ascidiacea; Phlebobranchia;
Cionidae; Ciona.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_136105) annotated using gene prediction method: Gnomon,
supported by EST evidence.
Also see:
Documentation of NCBI's Annotation Process
On Jan 21, 2026 this sequence version replaced XM_002129655.3.
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Full annotation
Annotation Name :: GCF_018327825.1-RS_2026_01
Annotation Pipeline :: NCBI Eukaryotic Genome Annotation
Pipeline (EGAP)
Annotation Software Version :: 10.5
Annotation Method :: Best-placed RefSeq; Gnomon;
cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 01/16/2026
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..806
/organism="Ciona intestinalis"
/mol_type="mRNA"
/db_xref="taxon:7719"
/chromosome="13"
/geo_loc_name="France:Roscoff"
/collection_date="2018-11-26"
gene 1..806
/gene="LOC100186730"
/note="small ribosomal subunit protein uS7; Derived by
automated computational analysis using gene prediction
method: Gnomon. Supporting evidence includes similarity
to: 2 ESTs, 1900 long SRA reads, 32 Proteins, and 100%
coverage of the annotated genomic feature by RNAseq
alignments, including 64 samples with support for all
annotated introns"
/db_xref="GeneID:100186730"
CDS 154..768
/gene="LOC100186730"
/codon_start=1
/product="small ribosomal subunit protein uS7"
/protein_id="XP_002129691.1"
/db_xref="GeneID:100186730"
/translation="
MEEDYEADVIVAEAPEVKLFGRWTTSDVQINDISLTDYLPVKDKYSKYLPHSSGRYQIKRFRKAQCPIVERLVNSMMMHGRNTGKKLLTVRIIKHAFEIIHLLTGENPLQVLVNAIINSGPREDSTRIGRAGTVRRQSVDVSPLRRVNQAIWLLCTGAREASFRNIKTIAECLADELINAHKGSSNSYAIKKKDELERVAKSNR"
misc_feature 205..765
/gene="LOC100186730"
/note="Eukaryota homolog of Ribosomal Protein S7; Region:
uS7_Eukaryote; cd14867"
/db_xref="CDD:271246"
misc_feature order(205..207,292..300,304..315,412..414,424..426)
/gene="LOC100186730"
/note="S9 interface [polypeptide binding]; other site"
/db_xref="CDD:271246"
misc_feature order(304..306,310..312,322..333,340..342,364..366,
373..375,379..393,403..417,424..426,544..552,556..558,
586..588,607..609,628..630,637..639,655..660)
/gene="LOC100186730"
/note="rRNA binding site [nucleotide binding]; other site"
/db_xref="CDD:271246"
misc_feature order(436..438,445..450,457..459,655..657,661..666)
/gene="LOC100186730"
/note="S25 interface [polypeptide binding]; other site"
/db_xref="CDD:271246"
misc_feature order(541..543,550..552,556..558,763..765)
/gene="LOC100186730"
/note="S11 interface [polypeptide binding]; other site"
/db_xref="CDD:271246"
polyA_site 806
/gene="LOC100186730"
/experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN
tgatgtattttggacgtttttagctaaaattgcacccgttttttggtatttttcgttaaaaatgatgaccagatagtgtagggatacgttatataattttttaagccaaatttagcccataaactcagactaaatcggcgatacacttttgacatggaggaagactacgaagcagacgttatcgtagctgaagcacctgaggtgaaattgttcggacgatggacaaccagtgatgtgcagatcaatgacatctcacttacggactacttacccgtgaaggacaaatactccaagtatcttccccacagctccgggcgttaccagatcaaacgcttccgtaaagcacaatgtcccattgtggagcgcttggttaactccatgatgatgcatgggcgtaataccggcaagaaactgctgactgttcgaatcattaaacatgcgttcgagattatccatctcttgactggtgaaaacccactccaagtgttggtgaatgcgattatcaacagtggtccacgtgaagattccactcgtattgggcgtgctggtactgtaagaagacagtctgtagacgtatcaccactgcgacgtgtcaaccaagctatctggttattgtgcaccggcgcacgtgaggcttctttccgtaacattaagacaattgctgagtgcttagctgatgaactcattaacgctcataagggctcatctaactcgtatgccatcaagaagaaggacgaacttgagagagtcgcgaaatccaaccgttaaaatgcatcggcattaatggaaataaaatcttaaaccaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]