2024-06-18 17:40:33, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NM_001047673 820 bp mRNA linear INV 22-NOV-2023 DEFINITION Caenorhabditis elegans Enolase-phosphatase E1 (F58H1.3), partial mRNA. ACCESSION NM_001047673 VERSION NM_001047673.4 DBLINK BioProject: PRJNA158 KEYWORDS RefSeq. SOURCE Caenorhabditis elegans ORGANISM Caenorhabditis elegans Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 820) AUTHORS Sulson,J.E. and Waterston,R. CONSRTM Caenorhabditis elegans Sequencing Consortium TITLE Genome sequence of the nematode C. elegans: a platform for investigating biology JOURNAL Science 282 (5396), 2012-2018 (1998) PUBMED 9851916 REMARK Erratum:[Science 1999 Jan 1;283(5398):35] REFERENCE 2 (bases 1 to 820) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (22-NOV-2023) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 820) AUTHORS WormBase. CONSRTM WormBase Consortium TITLE Direct Submission JOURNAL Submitted (29-OCT-2023) WormBase Group, European Bioinformatics Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org REFERENCE 4 (bases 1 to 820) AUTHORS Sulson,J.E. and Waterston,R. TITLE Direct Submission JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute at Washington University, St. Louis, MO 63110, USA COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This record is derived from an annotated genomic sequence (NC_003283). On May 27, 2020 this sequence version replaced NM_001047673.3. COMPLETENESS: incomplete on the 5' end. FEATURES Location/Qualifiers source 1..820 /organism="Caenorhabditis elegans" /mol_type="mRNA" /strain="Bristol N2" /db_xref="taxon:6239" /chromosome="V" gene <1..820 /gene="F58H1.3" /locus_tag="CELE_F58H1.3" /db_xref="GeneID:179634" /db_xref="WormBase:WBGene00010286" CDS 1..747 /gene="F58H1.3" /locus_tag="CELE_F58H1.3" /standard_name="F58H1.3a" /note="Confirmed by transcript evidence" /codon_start=1 /product="Enolase-phosphatase E1" /protein_id="NP_001041138.2" /db_xref="EnsemblGenomes-Gn:WBGene00010286" /db_xref="EnsemblGenomes-Tr:F58H1.3a" /db_xref="GeneID:179634" /db_xref="WormBase:WBGene00010286" /translation="
MTTTTIQFNALLLDIEGTITSISFVKDELFPYAFENVGNYLEEHYDNPATQIIVEDLRHIADQQAENDVAVVRIREPRKECIEDVTKNVRHWIKRDKKLTPMKALQGLIWEEAYQRGDVKGHVYPDVLPVLKIVENRKIPIYIYSSGSVHAQKLLFANSIEGDMTKILYGYFDTNIGLKGESNSYTKISERIKIPPSEILFLTDVEAEAAAAKKAGLQTKLVVRPGNAGLTQEAINAYGTIESLEEIL"
misc_feature 28..678 /gene="F58H1.3" /locus_tag="CELE_F58H1.3" /note="Enolase-phosphatase similar to human enolase-phosphatase E1 and and Xanthomonas oryzae pv. Oryzae enolase-phosphatase Xep; Region: HAD_EP; cd01629" /db_xref="CDD:319768" misc_feature order(40..54,73..75,85..90,328..330,433..441,451..453, 535..537,607..612,622..627) /gene="F58H1.3" /locus_tag="CELE_F58H1.3" /note="active site" /db_xref="CDD:319768" misc_feature 40..54 /gene="F58H1.3" /locus_tag="CELE_F58H1.3" /note="HAD signature motif I; other site" /db_xref="CDD:319768" ORIGIN
atgacaaccactactattcaattcaacgcgctgctcctagatattgagggtacaataaccagtatctcctttgttaaggatgagctttttccatacgcgttcgagaacgttggaaattatttggaggagcactacgacaatccagcaactcaaataattgttgaagatttgaggcacattgcagaccaacaagcggaaaatgatgtggcagttgtgcggatccgcgaaccaagaaaggaatgcattgaggatgtaacaaaaaatgtcagacactggataaaaagagacaaaaaactgacaccaatgaaagctctccaggggctcatttgggaagaggcttaccagcgcggagatgtgaaaggacatgtatatccggacgttttaccagttttgaaaattgttgaaaatagaaaaatcccgatctacatctactcatcgggatcggtccacgctcaaaagctcttgtttgccaattcaattgaaggagatatgaccaaaattctctatggctactttgacacaaatatcggtctgaagggagaaagcaattcatacacgaaaatcagcgagcgaattaaaattcctcccagtgaaatactattcctgactgatgttgaagcagaagcggctgctgccaagaaagctgggttacagacaaagttagtagttcgtcctggaaatgcgggtctaacacaagaagctataaacgcctacggaaccattgaaagtttggaagaaattttgtaattctttgtattcattgtattctttcctgaaacattgtttggagatctttaataaagccttcggtgtaaaaatt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]